Binding of a DNA fragment ( AGCTCAGGTCAAGGAGGTCAG ) with a DNA endogenous promoter that has a Vitamin D response element and __SP__ __NODE__ and __NODE__ protein and a protein protein complex consisting of mutant __NODE__ ( C terminal truncation with its AF 2 transcription activation domain deleted ) and of mutant __NODE__ ( C terminal truncation with its AF 2 transcription activation domain deleted ) occurs in a system of purified components .