vers la météo de la validation par utilisateur

Ingenuity022


precedent - 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 - suivant

Phrase 78 - PMID ?

Binding of a DNA fragment ( GCGTGAGCGCTCACAGGTCAATTCG ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .


Non annotée
Je ne sais pas
Je n'ai pas trouvé d'analyse satisfaisante


Commentaires :

Analyse 0
    +--------------------------------------------------------------SUBJ:V-N--------------------------------------------------------------+                          
    +----------------------------------------------------COMP:N-N(of)----------------------------------------------------+               |                          
    +---------------------------------COMP:N-N(of)--------------------------------+                                      |               +-----COMP:V-N(in)----+    
    +---COMP:N-N(of)--+                                           +--MOD_ATT:N-N--+                                      |               |          +MOD_ATT:N-+    
    |          +MOD_AT+-------APPOS------+                        |       +MOD_ATT+-SUBJ:V-N+COMP:N-N(of)+               |          +-NEG+          |    +MOD_A+    
    |          |      |                  |                        |       |       |         |            |               |          |    |          |    |     |    
 Binding of a DNA fragment ( GCGTGAGCGCTCACAGGTCAATTCG ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
COMP:N-N(of) (bind,fragment)
COMP:N-N(of) (bind,complex)
COMP:N-N(of) (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GCGTGAGCGCTCACAGGTCAATTCG)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
SUBJ:V-N (occur,bind)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)