vers la météo de la validation par utilisateur

Ingenuity027


precedent - 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 - suivant

Phrase 4 - PMID ?

Binding of a protein DNA complex consisting of DNA fragment ( TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG ) and of __NODE__ and of __NODE__ and a protein fragment ( 1056 1495 ) from __NODE__ protein does not occur in a system of purified components .


Non annotée
Je ne sais pas
Je n'ai pas trouvé d'analyse satisfaisante


Commentaires :

Analyse 0
    +-------------------------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------------------------+                                       
    |                                  +---------------------------------------------------------------------COMP:V-N(from)--------------------------------------------------------------------+               |                                       
    +------COMP:N-N(of)------+         |                                                                            +---------------------APPOS---------------------+                          |               |                                       
    |            +MOD_ATT:N-N+         |                                                                            +-------------COMP:N-N(of)-------------+        |                          |               |           +----COMP:N-N(of)----+      
    |            |     +MOD_A+-SUBJ:V-N+COMP:N-N(+--------------APPOS-------------+                                 +--COMP:N-N(of)-+             +MOD_ATT:+        |                  +MOD_ATT+          +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |            |     |     |         |         |                                |                                 |               |             |        |        |                  |       |          |    |           |          |         |      
 Binding of a protein DNA complex consisting of DNA fragment ( TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG ) and of __NODE__ and of __NODE__ and a protein fragment ( 1056 1495 ) from __NODE__ protein does not occur in a system of purified components .
COMP:N-N(of) (bind,complex)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,DNA)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,DNA)
COMP:V-N(from) (consist,protein)
APPOS (DNA,TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG)
COMP:N-N(of) (__NODE__,__NODE__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,@card@)
MOD_ATT:N-N (fragment,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (occur,bind)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 1
    +-------------------------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------------------------+                                       
    |                                  +---------------------------------------------------------------------COMP:V-N(from)--------------------------------------------------------------------+               |                                       
    +------COMP:N-N(of)------+         |                                                                            +------------------------APPOS-----------------------+                     |               |                                       
    |            +MOD_ATT:N-N+         |                                                                            +-------------COMP:N-N(of)-------------+             |                     |               |           +----COMP:N-N(of)----+      
    |            |     +MOD_A+-SUBJ:V-N+COMP:N-N(+--------------APPOS-------------+                                 +--COMP:N-N(of)-+             +MOD_ATT:+             |             +MOD_ATT+          +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |            |     |     |         |         |                                |                                 |               |             |        |             |             |       |          |    |           |          |         |      
 Binding of a protein DNA complex consisting of DNA fragment ( TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG ) and of __NODE__ and of __NODE__ and a protein fragment ( 1056 1495 ) from __NODE__ protein does not occur in a system of purified components .
COMP:N-N(of) (bind,complex)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,DNA)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,DNA)
COMP:V-N(from) (consist,protein)
APPOS (DNA,TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG)
COMP:N-N(of) (__NODE__,__NODE__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,@card@)
MOD_ATT:N-N (fragment,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (occur,bind)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 2
    +-------------------------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------------------------+                                       
    +-------------SUBJ:V-N-------------+---------------------------------------------------------------------COMP:V-N(from)--------------------------------------------------------------------+               |                                       
    +------COMP:N-N(of)------+         |                                                                            +---------------------APPOS---------------------+                          |               |                                       
    |            +MOD_ATT:N-N+         |                                                                            +-------------COMP:N-N(of)-------------+        |                          |               |           +----COMP:N-N(of)----+      
    |            |     +MOD_A+         +COMP:N-N(+--------------APPOS-------------+                                 +--COMP:N-N(of)-+             +MOD_ATT:+        |                  +MOD_ATT+          +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |            |     |     |         |         |                                |                                 |               |             |        |        |                  |       |          |    |           |          |         |      
 Binding of a protein DNA complex consisting of DNA fragment ( TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG ) and of __NODE__ and of __NODE__ and a protein fragment ( 1056 1495 ) from __NODE__ protein does not occur in a system of purified components .
COMP:N-N(of) (bind,complex)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,DNA)
SUBJ:V-N (consist,bind)
COMP:N-N(of) (consist,DNA)
COMP:V-N(from) (consist,protein)
APPOS (DNA,TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG)
COMP:N-N(of) (__NODE__,__NODE__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,@card@)
MOD_ATT:N-N (fragment,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (occur,bind)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 3
    +-------------------------------------------------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------------------------------------------------+                
    |                                  +-----------------------------------------------------------------COMP:V-N(from)----------------------------------------------------------------+                                              |                
    +------COMP:N-N(of)------+         |                                                                            +---------------------APPOS---------------------+                  |                                              |                
    |            +MOD_ATT:N-N+         |                                                                            +-------------COMP:N-N(of)-------------+        |                  |       +----SUBJ:V-N---+                      |                
    |            |     +MOD_A+-SUBJ:V-N+COMP:N-N(+--------------APPOS-------------+                                 +--COMP:N-N(of)-+             +MOD_ATT:+        |                  +----OBJ:V-N---+   +-NEG+COMP:V-N(in+MOD_+     +-OBJ:V-N-+      
    |            |     |     |         |         |                                |                                 |               |             |        |        |                  |       |      |   |    |           |    |     |         |      
 Binding of a protein DNA complex consisting of DNA fragment ( TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG ) and of __NODE__ and of __NODE__ and a protein fragment ( 1056 1495 ) from __NODE__ protein does not occur in a system of purified components .
COMP:N-N(of) (bind,complex)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,DNA)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,DNA)
COMP:V-N(from) (consist,__NODE__)
APPOS (DNA,TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG)
COMP:N-N(of) (__NODE__,__NODE__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,@card@)
MOD_ATT:N-N (fragment,protein)
OBJ:V-N (do,__NODE__)
SUBJ:V-N (occur,protein)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_POST:N-ADJ (system,of)
SUBJ:V-N (purify,bind)
OBJ:V-N (purify,component)

Analyse 4
    +-------------------------------------------------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------------------------------------------------+                
    |                                  +-----------------------------------------------------------------COMP:V-N(from)----------------------------------------------------------------+                                              |                
    +------COMP:N-N(of)------+         |                                                                            +------------------------APPOS-----------------------+             |                                              |                
    |            +MOD_ATT:N-N+         |                                                                            +-------------COMP:N-N(of)-------------+             |             |       +----SUBJ:V-N---+                      |                
    |            |     +MOD_A+-SUBJ:V-N+COMP:N-N(+--------------APPOS-------------+                                 +--COMP:N-N(of)-+             +MOD_ATT:+             |             +----OBJ:V-N---+   +-NEG+COMP:V-N(in+MOD_+     +-OBJ:V-N-+      
    |            |     |     |         |         |                                |                                 |               |             |        |             |             |       |      |   |    |           |    |     |         |      
 Binding of a protein DNA complex consisting of DNA fragment ( TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG ) and of __NODE__ and of __NODE__ and a protein fragment ( 1056 1495 ) from __NODE__ protein does not occur in a system of purified components .
COMP:N-N(of) (bind,complex)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,DNA)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,DNA)
COMP:V-N(from) (consist,__NODE__)
APPOS (DNA,TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG)
COMP:N-N(of) (__NODE__,__NODE__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,@card@)
MOD_ATT:N-N (fragment,protein)
OBJ:V-N (do,__NODE__)
SUBJ:V-N (occur,protein)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_POST:N-ADJ (system,of)
SUBJ:V-N (purify,bind)
OBJ:V-N (purify,component)

Analyse 5
    +-------------------------------------------------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------------------------------------------------+                
    +-------------SUBJ:V-N-------------+-----------------------------------------------------------------COMP:V-N(from)----------------------------------------------------------------+                                              |                
    +------COMP:N-N(of)------+         |                                                                            +---------------------APPOS---------------------+                  |                                              |                
    |            +MOD_ATT:N-N+         |                                                                            +-------------COMP:N-N(of)-------------+        |                  |       +----SUBJ:V-N---+                      |                
    |            |     +MOD_A+         +COMP:N-N(+--------------APPOS-------------+                                 +--COMP:N-N(of)-+             +MOD_ATT:+        |                  +----OBJ:V-N---+   +-NEG+COMP:V-N(in+MOD_+     +-OBJ:V-N-+      
    |            |     |     |         |         |                                |                                 |               |             |        |        |                  |       |      |   |    |           |    |     |         |      
 Binding of a protein DNA complex consisting of DNA fragment ( TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG ) and of __NODE__ and of __NODE__ and a protein fragment ( 1056 1495 ) from __NODE__ protein does not occur in a system of purified components .
COMP:N-N(of) (bind,complex)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,DNA)
SUBJ:V-N (consist,bind)
COMP:N-N(of) (consist,DNA)
COMP:V-N(from) (consist,__NODE__)
APPOS (DNA,TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG)
COMP:N-N(of) (__NODE__,__NODE__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,@card@)
MOD_ATT:N-N (fragment,protein)
OBJ:V-N (do,__NODE__)
SUBJ:V-N (occur,protein)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_POST:N-ADJ (system,of)
SUBJ:V-N (purify,bind)
OBJ:V-N (purify,component)

Analyse 6
    +-------------------------------------------------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------------------------------------------------+                
    +-------------SUBJ:V-N-------------+-----------------------------------------------------------------COMP:V-N(from)----------------------------------------------------------------+                                              |                
    +------COMP:N-N(of)------+         |                                                                            +------------------------APPOS-----------------------+             |                                              |                
    |            +MOD_ATT:N-N+         |                                                                            +-------------COMP:N-N(of)-------------+             |             |       +----SUBJ:V-N---+                      |                
    |            |     +MOD_A+         +COMP:N-N(+--------------APPOS-------------+                                 +--COMP:N-N(of)-+             +MOD_ATT:+             |             +----OBJ:V-N---+   +-NEG+COMP:V-N(in+MOD_+     +-OBJ:V-N-+      
    |            |     |     |         |         |                                |                                 |               |             |        |             |             |       |      |   |    |           |    |     |         |      
 Binding of a protein DNA complex consisting of DNA fragment ( TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG ) and of __NODE__ and of __NODE__ and a protein fragment ( 1056 1495 ) from __NODE__ protein does not occur in a system of purified components .
COMP:N-N(of) (bind,complex)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,DNA)
SUBJ:V-N (consist,bind)
COMP:N-N(of) (consist,DNA)
COMP:V-N(from) (consist,__NODE__)
APPOS (DNA,TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG)
COMP:N-N(of) (__NODE__,__NODE__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,@card@)
MOD_ATT:N-N (fragment,protein)
OBJ:V-N (do,__NODE__)
SUBJ:V-N (occur,protein)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_POST:N-ADJ (system,of)
SUBJ:V-N (purify,bind)
OBJ:V-N (purify,component)

Analyse 7
    +-------------------------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------------------------+                                       
    |                                  +---------------------------------------------------------------------COMP:V-N(from)--------------------------------------------------------------------+               |                                       
    +------COMP:N-N(of)------+         |                                                                            +---------------------APPOS---------------------+                          |               |                                       
    |            +MOD_ATT:N-N+         |                                                                            +-------------COMP:N-N(of)-------------+        |                          |               |           +----COMP:N-N(of)----+      
    |            |     +MOD_A+-SUBJ:V-N+COMP:N-N(+--------------APPOS-------------+                                 +--COMP:N-N(of)-+             +MOD_ATT:+        |                  +MOD_ATT+          +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |            |     |     |         |         |                                |                                 |               |             |        |        |                  |       |          |    |           |          |         |      
 Binding of a protein DNA complex consisting of DNA fragment ( TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG ) and of __NODE__ and of __NODE__ and a protein fragment ( 1056 1495 ) from __NODE__ protein does not occur in a system of purified components .
COMP:N-N(of) (bind,complex)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,DNA)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,DNA)
COMP:V-N(from) (consist,protein)
APPOS (DNA,TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG)
COMP:N-N(of) (__NODE__,__NODE__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,@card@)
MOD_ATT:N-N (fragment,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (occur,bind)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 8
    +-------------------------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------------------------+                                       
    |                                  +---------------------------------------------------------------------COMP:V-N(from)--------------------------------------------------------------------+               |                                       
    +------COMP:N-N(of)------+         |                                                                            +------------------------APPOS-----------------------+                     |               |                                       
    |            +MOD_ATT:N-N+         |                                                                            +-------------COMP:N-N(of)-------------+             |                     |               |           +----COMP:N-N(of)----+      
    |            |     +MOD_A+-SUBJ:V-N+COMP:N-N(+--------------APPOS-------------+                                 +--COMP:N-N(of)-+             +MOD_ATT:+             |             +MOD_ATT+          +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |            |     |     |         |         |                                |                                 |               |             |        |             |             |       |          |    |           |          |         |      
 Binding of a protein DNA complex consisting of DNA fragment ( TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG ) and of __NODE__ and of __NODE__ and a protein fragment ( 1056 1495 ) from __NODE__ protein does not occur in a system of purified components .
COMP:N-N(of) (bind,complex)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,DNA)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,DNA)
COMP:V-N(from) (consist,protein)
APPOS (DNA,TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG)
COMP:N-N(of) (__NODE__,__NODE__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,@card@)
MOD_ATT:N-N (fragment,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (occur,bind)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 9
    +-------------------------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------------------------+                                       
    +-------------SUBJ:V-N-------------+---------------------------------------------------------------------COMP:V-N(from)--------------------------------------------------------------------+               |                                       
    +------COMP:N-N(of)------+         |                                                                            +---------------------APPOS---------------------+                          |               |                                       
    |            +MOD_ATT:N-N+         |                                                                            +-------------COMP:N-N(of)-------------+        |                          |               |           +----COMP:N-N(of)----+      
    |            |     +MOD_A+         +COMP:N-N(+--------------APPOS-------------+                                 +--COMP:N-N(of)-+             +MOD_ATT:+        |                  +MOD_ATT+          +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |            |     |     |         |         |                                |                                 |               |             |        |        |                  |       |          |    |           |          |         |      
 Binding of a protein DNA complex consisting of DNA fragment ( TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG ) and of __NODE__ and of __NODE__ and a protein fragment ( 1056 1495 ) from __NODE__ protein does not occur in a system of purified components .
COMP:N-N(of) (bind,complex)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,DNA)
SUBJ:V-N (consist,bind)
COMP:N-N(of) (consist,DNA)
COMP:V-N(from) (consist,protein)
APPOS (DNA,TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG)
COMP:N-N(of) (__NODE__,__NODE__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,@card@)
MOD_ATT:N-N (fragment,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (occur,bind)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 10
    +-------------------------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------------------------+                                       
    +-------------SUBJ:V-N-------------+---------------------------------------------------------------------COMP:V-N(from)--------------------------------------------------------------------+               |                                       
    +------COMP:N-N(of)------+         |                                                                            +------------------------APPOS-----------------------+                     |               |                                       
    |            +MOD_ATT:N-N+         |                                                                            +-------------COMP:N-N(of)-------------+             |                     |               |           +----COMP:N-N(of)----+      
    |            |     +MOD_A+         +COMP:N-N(+--------------APPOS-------------+                                 +--COMP:N-N(of)-+             +MOD_ATT:+             |             +MOD_ATT+          +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |            |     |     |         |         |                                |                                 |               |             |        |             |             |       |          |    |           |          |         |      
 Binding of a protein DNA complex consisting of DNA fragment ( TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG ) and of __NODE__ and of __NODE__ and a protein fragment ( 1056 1495 ) from __NODE__ protein does not occur in a system of purified components .
COMP:N-N(of) (bind,complex)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,DNA)
SUBJ:V-N (consist,bind)
COMP:N-N(of) (consist,DNA)
COMP:V-N(from) (consist,protein)
APPOS (DNA,TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG)
COMP:N-N(of) (__NODE__,__NODE__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,@card@)
MOD_ATT:N-N (fragment,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (occur,bind)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 11
    +-------------------------------------------------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------------------------------------------------+                
    |                                  +-----------------------------------------------------------------COMP:V-N(from)----------------------------------------------------------------+                                              |                
    +------COMP:N-N(of)------+         |                                                                            +---------------------APPOS---------------------+                  |                                              |                
    |            +MOD_ATT:N-N+         |                                                                            +-------------COMP:N-N(of)-------------+        |                  |       +----SUBJ:V-N---+                      |                
    |            |     +MOD_A+-SUBJ:V-N+COMP:N-N(+--------------APPOS-------------+                                 +--COMP:N-N(of)-+             +MOD_ATT:+        |                  +----OBJ:V-N---+   +-NEG+COMP:V-N(in+MOD_+     +-OBJ:V-N-+      
    |            |     |     |         |         |                                |                                 |               |             |        |        |                  |       |      |   |    |           |    |     |         |      
 Binding of a protein DNA complex consisting of DNA fragment ( TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG ) and of __NODE__ and of __NODE__ and a protein fragment ( 1056 1495 ) from __NODE__ protein does not occur in a system of purified components .
COMP:N-N(of) (bind,complex)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,DNA)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,DNA)
COMP:V-N(from) (consist,__NODE__)
APPOS (DNA,TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG)
COMP:N-N(of) (__NODE__,__NODE__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,@card@)
MOD_ATT:N-N (fragment,protein)
OBJ:V-N (do,__NODE__)
SUBJ:V-N (occur,protein)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_POST:N-ADJ (system,of)
SUBJ:V-N (purify,bind)
OBJ:V-N (purify,component)

Analyse 12
    +-------------------------------------------------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------------------------------------------------+                
    |                                  +-----------------------------------------------------------------COMP:V-N(from)----------------------------------------------------------------+                                              |                
    +------COMP:N-N(of)------+         |                                                                            +------------------------APPOS-----------------------+             |                                              |                
    |            +MOD_ATT:N-N+         |                                                                            +-------------COMP:N-N(of)-------------+             |             |       +----SUBJ:V-N---+                      |                
    |            |     +MOD_A+-SUBJ:V-N+COMP:N-N(+--------------APPOS-------------+                                 +--COMP:N-N(of)-+             +MOD_ATT:+             |             +----OBJ:V-N---+   +-NEG+COMP:V-N(in+MOD_+     +-OBJ:V-N-+      
    |            |     |     |         |         |                                |                                 |               |             |        |             |             |       |      |   |    |           |    |     |         |      
 Binding of a protein DNA complex consisting of DNA fragment ( TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG ) and of __NODE__ and of __NODE__ and a protein fragment ( 1056 1495 ) from __NODE__ protein does not occur in a system of purified components .
COMP:N-N(of) (bind,complex)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,DNA)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,DNA)
COMP:V-N(from) (consist,__NODE__)
APPOS (DNA,TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG)
COMP:N-N(of) (__NODE__,__NODE__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,@card@)
MOD_ATT:N-N (fragment,protein)
OBJ:V-N (do,__NODE__)
SUBJ:V-N (occur,protein)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_POST:N-ADJ (system,of)
SUBJ:V-N (purify,bind)
OBJ:V-N (purify,component)

Analyse 13
    +-------------------------------------------------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------------------------------------------------+                
    +-------------SUBJ:V-N-------------+-----------------------------------------------------------------COMP:V-N(from)----------------------------------------------------------------+                                              |                
    +------COMP:N-N(of)------+         |                                                                            +------------------------APPOS-----------------------+             |                                              |                
    |            +MOD_ATT:N-N+         |                                                                            +-------------COMP:N-N(of)-------------+             |             |       +----SUBJ:V-N---+                      |                
    |            |     +MOD_A+         +COMP:N-N(+--------------APPOS-------------+                                 +--COMP:N-N(of)-+             +MOD_ATT:+             |             +----OBJ:V-N---+   +-NEG+COMP:V-N(in+MOD_+     +-OBJ:V-N-+      
    |            |     |     |         |         |                                |                                 |               |             |        |             |             |       |      |   |    |           |    |     |         |      
 Binding of a protein DNA complex consisting of DNA fragment ( TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG ) and of __NODE__ and of __NODE__ and a protein fragment ( 1056 1495 ) from __NODE__ protein does not occur in a system of purified components .
COMP:N-N(of) (bind,complex)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,DNA)
SUBJ:V-N (consist,bind)
COMP:N-N(of) (consist,DNA)
COMP:V-N(from) (consist,__NODE__)
APPOS (DNA,TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG)
COMP:N-N(of) (__NODE__,__NODE__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,@card@)
MOD_ATT:N-N (fragment,protein)
OBJ:V-N (do,__NODE__)
SUBJ:V-N (occur,protein)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_POST:N-ADJ (system,of)
SUBJ:V-N (purify,bind)
OBJ:V-N (purify,component)

Analyse 14
                             +------------------------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------------------------+                                                
                             |                                                                                      +-----------------------------------COMP:V-N(of)----------------------------------+                                                
                             |                                                                                      |               +---------------------------COMP:V-N(of)--------------------------+                                                
                             |                                                                                      |               |                      +---------------COMP:V-N(of)---------------+                                                
                 +MOD_ATT:N-N+                                                                                      |               |                      |                                   +----SUBJ:V-N---+           +----COMP:N-N(of)----+      
                 |     +MOD_A+         +COMP:N-N(+--------------APPOS-------------+                                 |               |             +MOD_ATT:+--APPOS-+                  +COMP:V-N(from)+   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
                 |     |     |         |         |                                |                                 |               |             |        |        |                  |       |      |   |    |           |          |         |      
 Binding of a protein DNA complex consisting of DNA fragment ( TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG ) and of __NODE__ and of __NODE__ and a protein fragment ( 1056 1495 ) from __NODE__ protein does not occur in a system of purified components .
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,DNA)
COMP:N-N(of) (consist,DNA)
APPOS (DNA,TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG)
MOD_ATT:N-N (fragment,protein)
APPOS (fragment,@card@)
COMP:V-N(of) (do,complex)
COMP:V-N(of) (do,__NODE__)
COMP:V-N(of) (do,__NODE__)
COMP:V-N(of) (do,fragment)
COMP:V-N(from) (do,__NODE__)
SUBJ:V-N (occur,protein)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 15
                             +------------------------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------------------------+                                                
                             |                                                                                      +-----------------------------------COMP:V-N(of)----------------------------------+                                                
                             |                                                                                      |               +---------------------------COMP:V-N(of)--------------------------+                                                
                             |                                                                                      |               |                      +---------------COMP:V-N(of)---------------+                                                
                 +MOD_ATT:N-N+                                                                                      |               |                      |                                   +----SUBJ:V-N---+           +----COMP:N-N(of)----+      
                 |     +MOD_A+         +COMP:N-N(+--------------APPOS-------------+                                 |               |             +MOD_ATT:+----APPOS----+             +COMP:V-N(from)+   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
                 |     |     |         |         |                                |                                 |               |             |        |             |             |       |      |   |    |           |          |         |      
 Binding of a protein DNA complex consisting of DNA fragment ( TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG ) and of __NODE__ and of __NODE__ and a protein fragment ( 1056 1495 ) from __NODE__ protein does not occur in a system of purified components .
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,DNA)
COMP:N-N(of) (consist,DNA)
APPOS (DNA,TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG)
MOD_ATT:N-N (fragment,protein)
APPOS (fragment,@card@)
COMP:V-N(of) (do,complex)
COMP:V-N(of) (do,__NODE__)
COMP:V-N(of) (do,__NODE__)
COMP:V-N(of) (do,fragment)
COMP:V-N(from) (do,__NODE__)
SUBJ:V-N (occur,protein)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 16
                             +------------------------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------------------------+                                                
                             |                                                                                      +-----------------------------------COMP:V-N(of)----------------------------------+                                                
                             |                                                                                      |               +---------------------------COMP:V-N(of)--------------------------+                                                
                             |                                                                                      |               |                      +---------------COMP:V-N(of)---------------+                                                
                 +MOD_ATT:N-N+                                                                                      |               |                      |                                   +----SUBJ:V-N---+           +----COMP:N-N(of)----+      
                 |     +MOD_A+         +COMP:N-N(+--------------APPOS-------------+                                 |               |             +MOD_ATT:+--APPOS-+                  +COMP:V-N(from)+   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
                 |     |     |         |         |                                |                                 |               |             |        |        |                  |       |      |   |    |           |          |         |      
 Binding of a protein DNA complex consisting of DNA fragment ( TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG ) and of __NODE__ and of __NODE__ and a protein fragment ( 1056 1495 ) from __NODE__ protein does not occur in a system of purified components .
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,DNA)
COMP:N-N(of) (consist,DNA)
APPOS (DNA,TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG)
MOD_ATT:N-N (fragment,protein)
APPOS (fragment,@card@)
COMP:V-N(of) (do,complex)
COMP:V-N(of) (do,__NODE__)
COMP:V-N(of) (do,__NODE__)
COMP:V-N(of) (do,fragment)
COMP:V-N(from) (do,__NODE__)
SUBJ:V-N (occur,protein)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 17
                             +------------------------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------------------------+                                                
                             |                                                                                      +-----------------------------------COMP:V-N(of)----------------------------------+                                                
                             |                                                                                      |               +---------------------------COMP:V-N(of)--------------------------+                                                
                             |                                                                                      |               |                      +---------------COMP:V-N(of)---------------+                                                
                 +MOD_ATT:N-N+                                                                                      |               |                      |                                   +----SUBJ:V-N---+           +----COMP:N-N(of)----+      
                 |     +MOD_A+         +COMP:N-N(+--------------APPOS-------------+                                 |               |             +MOD_ATT:+----APPOS----+             +COMP:V-N(from)+   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
                 |     |     |         |         |                                |                                 |               |             |        |             |             |       |      |   |    |           |          |         |      
 Binding of a protein DNA complex consisting of DNA fragment ( TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG ) and of __NODE__ and of __NODE__ and a protein fragment ( 1056 1495 ) from __NODE__ protein does not occur in a system of purified components .
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,DNA)
COMP:N-N(of) (consist,DNA)
APPOS (DNA,TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG)
MOD_ATT:N-N (fragment,protein)
APPOS (fragment,@card@)
COMP:V-N(of) (do,complex)
COMP:V-N(of) (do,__NODE__)
COMP:V-N(of) (do,__NODE__)
COMP:V-N(of) (do,fragment)
COMP:V-N(from) (do,__NODE__)
SUBJ:V-N (occur,protein)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 18
                             +------------------------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------------------------+                                                
                             |                                                                                      +-----------------------------------COMP:V-N(of)----------------------------------+                                                
                             |                                                                                      |               +---------------------------COMP:V-N(of)--------------------------+                                                
                             |                                                                                      |               |                      +---------------COMP:V-N(of)---------------+                                                
                 +MOD_ATT:N-N+         +---------------COMP:N-N(of)---------------+                                 |               |                      |                                   +----SUBJ:V-N---+           +----COMP:N-N(of)----+      
                 |     +MOD_A+         |         +MOD_AT+-------MOD_ATT:N-N-------+                                 |               |             +MOD_ATT:+--APPOS-+                  +COMP:V-N(from)+   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
                 |     |     |         |         |      |                         |                                 |               |             |        |        |                  |       |      |   |    |           |          |         |      
 Binding of a protein DNA complex consisting of DNA fragment ( TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG ) and of __NODE__ and of __NODE__ and a protein fragment ( 1056 1495 ) from __NODE__ protein does not occur in a system of purified components .
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,DNA)
COMP:N-N(of) (consist,TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG)
MOD_ATT:N-N (fragment,DNA)
MOD_ATT:N-N (TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG,fragment)
MOD_ATT:N-N (fragment,protein)
APPOS (fragment,@card@)
COMP:V-N(of) (do,complex)
COMP:V-N(of) (do,__NODE__)
COMP:V-N(of) (do,__NODE__)
COMP:V-N(of) (do,fragment)
COMP:V-N(from) (do,__NODE__)
SUBJ:V-N (occur,protein)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 19
                             +------------------------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------------------------+                                                
                             |                                                                                      +-----------------------------------COMP:V-N(of)----------------------------------+                                                
                             |                                                                                      |               +---------------------------COMP:V-N(of)--------------------------+                                                
                             |                                                                                      |               |                      +---------------COMP:V-N(of)---------------+                                                
                 +MOD_ATT:N-N+         +---------------COMP:N-N(of)---------------+                                 |               |                      |                                   +----SUBJ:V-N---+           +----COMP:N-N(of)----+      
                 |     +MOD_A+         |         +MOD_AT+-------MOD_ATT:N-N-------+                                 |               |             +MOD_ATT:+----APPOS----+             +COMP:V-N(from)+   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
                 |     |     |         |         |      |                         |                                 |               |             |        |             |             |       |      |   |    |           |          |         |      
 Binding of a protein DNA complex consisting of DNA fragment ( TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG ) and of __NODE__ and of __NODE__ and a protein fragment ( 1056 1495 ) from __NODE__ protein does not occur in a system of purified components .
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,DNA)
COMP:N-N(of) (consist,TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG)
MOD_ATT:N-N (fragment,DNA)
MOD_ATT:N-N (TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG,fragment)
MOD_ATT:N-N (fragment,protein)
APPOS (fragment,@card@)
COMP:V-N(of) (do,complex)
COMP:V-N(of) (do,__NODE__)
COMP:V-N(of) (do,__NODE__)
COMP:V-N(of) (do,fragment)
COMP:V-N(from) (do,__NODE__)
SUBJ:V-N (occur,protein)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 20
                             +------------------------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------------------------+                                                
                             |                                                                                      +-----------------------------------COMP:V-N(of)----------------------------------+                                                
                             |                                                                                      |               +---------------------------COMP:V-N(of)--------------------------+                                                
                             |                                                                                      |               |                      +---------------COMP:V-N(of)---------------+                                                
                 +MOD_ATT:N-N+         +---------------COMP:N-N(of)---------------+                                 |               |                      |                                   +----SUBJ:V-N---+           +----COMP:N-N(of)----+      
                 |     +MOD_A+         |         +MOD_AT+-------MOD_ATT:N-N-------+                                 |               |             +MOD_ATT:+--APPOS-+                  +COMP:V-N(from)+   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
                 |     |     |         |         |      |                         |                                 |               |             |        |        |                  |       |      |   |    |           |          |         |      
 Binding of a protein DNA complex consisting of DNA fragment ( TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG ) and of __NODE__ and of __NODE__ and a protein fragment ( 1056 1495 ) from __NODE__ protein does not occur in a system of purified components .
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,DNA)
COMP:N-N(of) (consist,TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG)
MOD_ATT:N-N (fragment,DNA)
MOD_ATT:N-N (TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG,fragment)
MOD_ATT:N-N (fragment,protein)
APPOS (fragment,@card@)
COMP:V-N(of) (do,complex)
COMP:V-N(of) (do,__NODE__)
COMP:V-N(of) (do,__NODE__)
COMP:V-N(of) (do,fragment)
COMP:V-N(from) (do,__NODE__)
SUBJ:V-N (occur,protein)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 21
                             +------------------------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------------------------+                                                
                             |                                                                                      +-----------------------------------COMP:V-N(of)----------------------------------+                                                
                             |                                                                                      |               +---------------------------COMP:V-N(of)--------------------------+                                                
                             |                                                                                      |               |                      +---------------COMP:V-N(of)---------------+                                                
                 +MOD_ATT:N-N+         +---------------COMP:N-N(of)---------------+                                 |               |                      |                                   +----SUBJ:V-N---+           +----COMP:N-N(of)----+      
                 |     +MOD_A+         |         +MOD_AT+-------MOD_ATT:N-N-------+                                 |               |             +MOD_ATT:+----APPOS----+             +COMP:V-N(from)+   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
                 |     |     |         |         |      |                         |                                 |               |             |        |             |             |       |      |   |    |           |          |         |      
 Binding of a protein DNA complex consisting of DNA fragment ( TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG ) and of __NODE__ and of __NODE__ and a protein fragment ( 1056 1495 ) from __NODE__ protein does not occur in a system of purified components .
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,DNA)
COMP:N-N(of) (consist,TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG)
MOD_ATT:N-N (fragment,DNA)
MOD_ATT:N-N (TCGATACGATCGTGACCTATTAGGAGGTCAACAGACGGG,fragment)
MOD_ATT:N-N (fragment,protein)
APPOS (fragment,@card@)
COMP:V-N(of) (do,complex)
COMP:V-N(of) (do,__NODE__)
COMP:V-N(of) (do,__NODE__)
COMP:V-N(of) (do,fragment)
COMP:V-N(from) (do,__NODE__)
SUBJ:V-N (occur,protein)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)