Validation pour Ingenuity030

vers la météo de la validation par utilisateur

Ingenuity030

precedent - 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 - suivant

Phrase 40 - PMID ?

Binding of bZIP domain from NODE protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant SP NODE gene ( C 248T G 247T with its NODE response element mutated ) does not occur in a system of purified components .

name="reponse" value="NA"> Non annotée
name="reponse" value="JSP"> Je ne sais pas
name="reponse" value="INS"> Je n'ai pas trouvé d'analyse satisfaisante

Commentaires :

<?php echo $Com ; ?>

name="reponse" value="A0">Analyse 0

    +-------------------------------------------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------------------------------------------+                                       
    |                                                                                                                                                   +------------COMP:ADJ-N(with)-----------+                         |                                       
    |                                                                                                                    +-MOD_ATT:N-ADJ+               |                      +--MOD_ATT:N-ADJ-+                         |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+------------------------------APPOS-----------------------------+            |      +MOD_ATT+-MOD_POST:N-ADJ+                      |        +MOD_ATT+SUBJ:V_+            +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |                                                                |            |      |       |               |                      |        |       |       |            |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
SUBJ:V-N (occur,bind)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A1">Analyse 1

    +-------------------------------------------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------------------------------------------+                                       
    |                                                                                                                                                          +--------COMP:ADJ-N(with)--------+                         |                                       
    |                                                                                                                    +-MOD_ATT:N-ADJ+                      |               +--MOD_ATT:N-ADJ-+                         |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+------------------------------APPOS-----------------------------+            |      +MOD_ATT+----MOD_POST:N-ADJ----+               |        +MOD_ATT+SUBJ:V_+            +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |                                                                |            |      |       |                      |               |        |       |       |            |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
SUBJ:V-N (occur,bind)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A2">Analyse 2

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
                                 +----------MOD_ATT:N-ADJ---------+                                                             |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
                                 |         +------MOD_ATT:N-N-----+                                                             |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  |         |             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |             |        |                    |                                 |      |       |               |                      |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
MOD_ATT:N-ADJ (fragment,__NODE__)
MOD_ATT:N-N (fragment,protein(s))
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A3">Analyse 3

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
                                 +----------MOD_ATT:N-ADJ---------+                                                             |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
                                 |         +------MOD_ATT:N-N-----+                                                             |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  |         |             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |             |        |                    |                                 |      |       |                      |               |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
MOD_ATT:N-ADJ (fragment,__NODE__)
MOD_ATT:N-N (fragment,protein(s))
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A4">Analyse 4

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
                                                                                                                                |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
                                                                                                                                |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |             |        |                    |                                 |      |       |               |                      |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A5">Analyse 5

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
                                                                                                                                |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
                                                                                                                                |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |             |        |                    |                                 |      |       |                      |               |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A6">Analyse 6

    +-------------------------------------------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------------------------------------------+                                       
    |                                                                                                                                                   +------------COMP:ADJ-N(with)-----------+                         |                                       
    |         +-------COMP:N-N(from)-------+                                                                             +-MOD_ATT:N-ADJ+               |                      +--MOD_ATT:N-ADJ-+                         |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+------------------------------APPOS-----------------------------+            |      +MOD_ATT+-MOD_POST:N-ADJ+                      |        +MOD_ATT+SUBJ:V_+            +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |                                                                |            |      |       |               |                      |        |       |       |            |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
COMP:N-N(from) (bZIP,protein(s))
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
SUBJ:V-N (occur,bind)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A7">Analyse 7

    +-------------------------------------------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------------------------------------------+                                       
    |                                                                                                                                                          +--------COMP:ADJ-N(with)--------+                         |                                       
    |         +-------COMP:N-N(from)-------+                                                                             +-MOD_ATT:N-ADJ+                      |               +--MOD_ATT:N-ADJ-+                         |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+------------------------------APPOS-----------------------------+            |      +MOD_ATT+----MOD_POST:N-ADJ----+               |        +MOD_ATT+SUBJ:V_+            +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |                                                                |            |      |       |                      |               |        |       |       |            |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
COMP:N-N(from) (bZIP,protein(s))
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
SUBJ:V-N (occur,bind)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A8">Analyse 8

    +-------------------------------------------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------------------------------------------+                                       
    |                                                                                                                                                   +------------COMP:ADJ-N(with)-----------+                         |                                       
    |                                                                                                                    +-MOD_ATT:N-ADJ+               |                      +--MOD_ATT:N-ADJ-+                         |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+------------------------------APPOS-----------------------------+            |      +MOD_ATT+-MOD_POST:N-ADJ+                      |        +MOD_ATT+                    +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |                                                                |            |      |       |               |                      |        |       |                    |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V-N (occur,bind)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A9">Analyse 9

    +-------------------------------------------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------------------------------------------+                                       
    |                                                                                                                                                          +--------COMP:ADJ-N(with)--------+                         |                                       
    |                                                                                                                    +-MOD_ATT:N-ADJ+                      |               +--MOD_ATT:N-ADJ-+                         |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+------------------------------APPOS-----------------------------+            |      +MOD_ATT+----MOD_POST:N-ADJ----+               |        +MOD_ATT+                    +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |                                                                |            |      |       |                      |               |        |       |                    |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V-N (occur,bind)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A10">Analyse 10

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
              +-----------------------------COMP:N-N(from)-----------------------------+                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                  +----------MOD_ATT:N-ADJ---------+                    |                                        |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              |                  |         +------MOD_ATT:N-N-----+                    |                                        |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  |         |             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |             |        |                    |                                 |      |       |               |                      |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
COMP:N-N(from) (bZIP,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
MOD_ATT:N-ADJ (fragment,__NODE__)
MOD_ATT:N-N (fragment,protein(s))
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A11">Analyse 11

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
                                                                                                                                |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
                                                                                                                                |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+------------------------------APPOS-----------------------------+            +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |                                                                |            |      |       |               |                      |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A12">Analyse 12

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
              +-----------------------------COMP:N-N(from)-----------------------------+                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                  +----------MOD_ATT:N-ADJ---------+                    |                                        |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              |                  |         +------MOD_ATT:N-N-----+                    |                                        |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  |         |             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |             |        |                    |                                 |      |       |                      |               |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
COMP:N-N(from) (bZIP,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
MOD_ATT:N-ADJ (fragment,__NODE__)
MOD_ATT:N-N (fragment,protein(s))
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A13">Analyse 13

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
                                                                                                                                |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
                                                                                                                                |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+------------------------------APPOS-----------------------------+            +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |                                                                |            |      |       |                      |               |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A14">Analyse 14

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
                                                                                                                                |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
                                           +----------------MOD_ATT:N-N----------------+                                        |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |             |        |                    |                                 |      |       |               |                      |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,protein(s))
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A15">Analyse 15

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
                                                                                                                                |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
                                           +----------------MOD_ATT:N-N----------------+                                        |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |             |        |                    |                                 |      |       |                      |               |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,protein(s))
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A16">Analyse 16

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
                                 +----------MOD_ATT:N-ADJ---------+                                                             |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
                                 |         +------MOD_ATT:N-N-----+                                                             |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  |         |             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |             |        |                    |                                 |      |       |               |                      |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
MOD_ATT:N-ADJ (fragment,__NODE__)
MOD_ATT:N-N (fragment,protein(s))
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A17">Analyse 17

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
                                 +----------MOD_ATT:N-ADJ---------+                                                             |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
                                 |         +------MOD_ATT:N-N-----+                                                             |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  |         |             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |             |        |                    |                                 |      |       |                      |               |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
MOD_ATT:N-ADJ (fragment,__NODE__)
MOD_ATT:N-N (fragment,protein(s))
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A18">Analyse 18

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              +-----------------------------COMP:N-N(from)-----------------------------+                                        |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              +-------COMP:N-N(from)-------+                                           |                                        |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |             |        |                    |                                 |      |       |               |                      |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
COMP:N-N(from) (bZIP,protein(s))
COMP:N-N(from) (bZIP,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A19">Analyse 19

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              +-----------------------------COMP:N-N(from)-----------------------------+                                        |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              +-------COMP:N-N(from)-------+                                           |                                        |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |             |        |                    |                                 |      |       |                      |               |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
COMP:N-N(from) (bZIP,protein(s))
COMP:N-N(from) (bZIP,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A20">Analyse 20

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
                                                                                                                                |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
                                                                                                                                |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+                                                                             +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |                                                                             |      |       |               |                      |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A21">Analyse 21

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
                                                                                                                                |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
                                                                                                                                |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+                                                                             +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |                                                                             |      |       |                      |               |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A22">Analyse 22

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
                                                                                                                                |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
                                                                                                                                |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |             |        |                    |                                 |      |       |               |                      |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A23">Analyse 23

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
                                                                                                                                |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
                                                                                                                                |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |             |        |                    |                                 |      |       |                      |               |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A24">Analyse 24

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
                                           +----------------MOD_ATT:N-N----------------+                                        |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
                                 +----------MOD_ATT:N-ADJ---------+                    |                                        |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |             |        |                    |                                 |      |       |               |                      |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (fragment,__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,protein(s))
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A25">Analyse 25

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
                                           +----------------MOD_ATT:N-N----------------+                                        |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
                                 +----------MOD_ATT:N-ADJ---------+                    |                                        |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |             |        |                    |                                 |      |       |                      |               |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (fragment,__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,protein(s))
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A26">Analyse 26

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
    +--------------------------------------OBJ:V-N-------------------------------------+                                        |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
    |         +-------COMP:N-N(from)-------+                                           |                                        |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |             |        |                    |                                 |      |       |               |                      |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
OBJ:V-N (bind,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
COMP:N-N(from) (bZIP,protein(s))
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A27">Analyse 27

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
    +--------------------------------------OBJ:V-N-------------------------------------+                                        |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
    |         +-------COMP:N-N(from)-------+                                           |                                        |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |             |        |                    |                                 |      |       |                      |               |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
OBJ:V-N (bind,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
COMP:N-N(from) (bZIP,protein(s))
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A28">Analyse 28

    +-------------------------------------------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------------------------------------------+                                       
    |                                                                                                                                                   +------------COMP:ADJ-N(with)-----------+                         |                                       
    |         +-------COMP:N-N(from)-------+                                                                             +-MOD_ATT:N-ADJ+               |                      +--MOD_ATT:N-ADJ-+                         |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+------------------------------APPOS-----------------------------+            |      +MOD_ATT+-MOD_POST:N-ADJ+                      |        +MOD_ATT+                    +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |                                                                |            |      |       |               |                      |        |       |                    |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
COMP:N-N(from) (bZIP,protein(s))
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V-N (occur,bind)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A29">Analyse 29

    +-------------------------------------------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------------------------------------------+                                       
    |                                                                                                                                                          +--------COMP:ADJ-N(with)--------+                         |                                       
    |         +-------COMP:N-N(from)-------+                                                                             +-MOD_ATT:N-ADJ+                      |               +--MOD_ATT:N-ADJ-+                         |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+------------------------------APPOS-----------------------------+            |      +MOD_ATT+----MOD_POST:N-ADJ----+               |        +MOD_ATT+                    +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |                                                                |            |      |       |                      |               |        |       |                    |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
COMP:N-N(from) (bZIP,protein(s))
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V-N (occur,bind)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A30">Analyse 30

    +-------------------------------------------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------------------------------------------+                                       
    +----------------OBJ:V-N---------------+                                                                                                                                                                              |                                       
    |         +---------MOD_ATT:N-N--------+                                                                                                            +------------COMP:ADJ-N(with)-----------+                         |                                       
    |         |     +------MOD_ATT:N-N-----+                                                                             +-MOD_ATT:N-ADJ+               |                      +--MOD_ATT:N-ADJ-+                         |           +----COMP:N-N(of)----+      
    |         |     |            +MOD_ATT:N+------------------------------APPOS-----------------------------+            |      +MOD_ATT+-MOD_POST:N-ADJ+                      |        +MOD_ATT+SUBJ:V_+            +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |     |            |         |                                                                |            |      |       |               |                      |        |       |       |            |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,protein(s))
MOD_ATT:N-N (protein(s),bZIP)
MOD_ATT:N-N (protein(s),domain)
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
SUBJ:V-N (occur,bind)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A31">Analyse 31

    +-------------------------------------------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------------------------------------------+                                       
    +----------------OBJ:V-N---------------+                                                                                                                                                                              |                                       
    |         +---------MOD_ATT:N-N--------+                                                                                                                   +--------COMP:ADJ-N(with)--------+                         |                                       
    |         |     +------MOD_ATT:N-N-----+                                                                             +-MOD_ATT:N-ADJ+                      |               +--MOD_ATT:N-ADJ-+                         |           +----COMP:N-N(of)----+      
    |         |     |            +MOD_ATT:N+------------------------------APPOS-----------------------------+            |      +MOD_ATT+----MOD_POST:N-ADJ----+               |        +MOD_ATT+SUBJ:V_+            +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |     |            |         |                                                                |            |      |       |                      |               |        |       |       |            |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,protein(s))
MOD_ATT:N-N (protein(s),bZIP)
MOD_ATT:N-N (protein(s),domain)
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
SUBJ:V-N (occur,bind)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A32">Analyse 32

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
                                                                                                                                |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              +-------COMP:N-N(from)-------+                                                                                    |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+------------------------------APPOS-----------------------------+            +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |                                                                |            |      |       |               |                      |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
COMP:N-N(from) (bZIP,protein(s))
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A33">Analyse 33

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
                                                                                                                                |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              +-------COMP:N-N(from)-------+                                                                                    |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+------------------------------APPOS-----------------------------+            +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |                                                                |            |      |       |                      |               |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
COMP:N-N(from) (bZIP,protein(s))
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A34">Analyse 34

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              +-----------------------------COMP:N-N(from)-----------------------------+                                        |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              |                            +----------------MOD_ATT:N-N----------------+                                        |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |             |        |                    |                                 |      |       |               |                      |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
COMP:N-N(from) (bZIP,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,protein(s))
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A35">Analyse 35

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              +-----------------------------COMP:N-N(from)-----------------------------+                                        |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              |                            +----------------MOD_ATT:N-N----------------+                                        |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |             |        |                    |                                 |      |       |                      |               |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
COMP:N-N(from) (bZIP,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,protein(s))
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A36">Analyse 36

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
              +-----------------------------COMP:N-N(from)-----------------------------+                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                  +----------MOD_ATT:N-ADJ---------+                    |                                        |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              |                  |         +------MOD_ATT:N-N-----+                    |                                        |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  |         |             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |             |        |                    |                                 |      |       |               |                      |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
COMP:N-N(from) (bZIP,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
MOD_ATT:N-ADJ (fragment,__NODE__)
MOD_ATT:N-N (fragment,protein(s))
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A37">Analyse 37

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
                                                                                                                                |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
                                                                                                                                |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+------------------------------APPOS-----------------------------+            +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |                                                                |            |      |       |               |                      |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A38">Analyse 38

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
              +-----------------------------COMP:N-N(from)-----------------------------+                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                  +----------MOD_ATT:N-ADJ---------+                    |                                        |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              |                  |         +------MOD_ATT:N-N-----+                    |                                        |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  |         |             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |             |        |                    |                                 |      |       |                      |               |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
COMP:N-N(from) (bZIP,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
MOD_ATT:N-ADJ (fragment,__NODE__)
MOD_ATT:N-N (fragment,protein(s))
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A39">Analyse 39

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
                                                                                                                                |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
                                                                                                                                |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+------------------------------APPOS-----------------------------+            +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |                                                                |            |      |       |                      |               |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A40">Analyse 40

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
                                                                                                                                |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
                                           +----------------MOD_ATT:N-N----------------+                                        |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |             |        |                    |                                 |      |       |               |                      |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,protein(s))
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A41">Analyse 41

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
                                                                                                                                |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
                                           +----------------MOD_ATT:N-N----------------+                                        |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |             |        |                    |                                 |      |       |                      |               |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,protein(s))
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A42">Analyse 42

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              +----------------------------------------COMP:N-N(from)---------------------------------------+                   |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              +-------COMP:N-N(from)-------+                                                                |                   |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+                                                                |            +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |                                                                |            |      |       |               |                      |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
COMP:N-N(from) (bZIP,protein(s))
COMP:N-N(from) (bZIP,@card@)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A43">Analyse 43

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              +----------------------------------------COMP:N-N(from)---------------------------------------+                   |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              +-------COMP:N-N(from)-------+                                                                |                   |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+                                                                |            +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |                                                                |            |      |       |                      |               |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
COMP:N-N(from) (bZIP,protein(s))
COMP:N-N(from) (bZIP,@card@)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A44">Analyse 44

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              +-----------------------------COMP:N-N(from)-----------------------------+                                        |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              +-------COMP:N-N(from)-------+                                           |                                        |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |             |        |                    |                                 |      |       |               |                      |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
COMP:N-N(from) (bZIP,protein(s))
COMP:N-N(from) (bZIP,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A45">Analyse 45

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              +-----------------------------COMP:N-N(from)-----------------------------+                                        |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              +-------COMP:N-N(from)-------+                                           |                                        |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |             |        |                    |                                 |      |       |                      |               |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
COMP:N-N(from) (bZIP,protein(s))
COMP:N-N(from) (bZIP,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A46">Analyse 46

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
              +-----------------------------COMP:N-N(from)-----------------------------+                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                            +----------------MOD_ATT:N-N----------------+                                        |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              |                  +----------MOD_ATT:N-ADJ---------+                    |                                        |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |             |        |                    |                                 |      |       |               |                      |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
COMP:N-N(from) (bZIP,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (fragment,__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,protein(s))
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A47">Analyse 47

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
              +-----------------------------COMP:N-N(from)-----------------------------+                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                            +----------------MOD_ATT:N-N----------------+                                        |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              |                  +----------MOD_ATT:N-ADJ---------+                    |                                        |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |             |        |                    |                                 |      |       |                      |               |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
COMP:N-N(from) (bZIP,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (fragment,__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,protein(s))
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A48">Analyse 48

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
                                                                                                                                |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
                                                                                                                                |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+                                                                             +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |                                                                             |      |       |               |                      |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A49">Analyse 49

    +--------------------------------------OBJ:V-N-------------------------------------+                                                +-------------------------------------SUBJ:V-N------------------------------------+                                       
    +----------------OBJ:V-N---------------+                                           |                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
    |         +---------MOD_ATT:N-N--------+                                           |                                        |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
    |         |     +------MOD_ATT:N-N-----+                                           |                                        |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    |         |     |            +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |     |            |         |             |        |                    |                                 |      |       |               |                      |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,protein(s))
OBJ:V-N (bind,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
MOD_ATT:N-N (protein(s),bZIP)
MOD_ATT:N-N (protein(s),domain)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A50">Analyse 50

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
                                                                                                                                |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
                                                                                                                                |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+                                                                             +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |                                                                             |      |       |                      |               |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A51">Analyse 51

    +--------------------------------------OBJ:V-N-------------------------------------+                                                +-------------------------------------SUBJ:V-N------------------------------------+                                       
    +----------------OBJ:V-N---------------+                                           |                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
    |         +---------MOD_ATT:N-N--------+                                           |                                        |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
    |         |     +------MOD_ATT:N-N-----+                                           |                                        |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    |         |     |            +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |     |            |         |             |        |                    |                                 |      |       |                      |               |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,protein(s))
OBJ:V-N (bind,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
MOD_ATT:N-N (protein(s),bZIP)
MOD_ATT:N-N (protein(s),domain)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A52">Analyse 52

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
    +------------------------------------------------OBJ:V-N------------------------------------------------+                   |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
    |         +-------COMP:N-N(from)-------+                                                                |                   |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+                                                                |            +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |                                                                |            |      |       |               |                      |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
OBJ:V-N (bind,@card@)
COMP:N-N(from) (bZIP,protein(s))
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A53">Analyse 53

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
    +------------------------------------------------OBJ:V-N------------------------------------------------+                   |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
    |         +-------COMP:N-N(from)-------+                                                                |                   |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+                                                                |            +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |                                                                |            |      |       |                      |               |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
OBJ:V-N (bind,@card@)
COMP:N-N(from) (bZIP,protein(s))
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A54">Analyse 54

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
                                           +----------------MOD_ATT:N-N----------------+                                        |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
                                 +----------MOD_ATT:N-ADJ---------+                    |                                        |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |             |        |                    |                                 |      |       |               |                      |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (fragment,__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,protein(s))
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A55">Analyse 55

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
                                           +----------------MOD_ATT:N-N----------------+                                        |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
                                 +----------MOD_ATT:N-ADJ---------+                    |                                        |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |             |        |                    |                                 |      |       |                      |               |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (fragment,__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,protein(s))
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A56">Analyse 56

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
    +--------------------------------------OBJ:V-N-------------------------------------+                                        |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
    |         +-------COMP:N-N(from)-------+                                           |                                        |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |             |        |                    |                                 |      |       |               |                      |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
OBJ:V-N (bind,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
COMP:N-N(from) (bZIP,protein(s))
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A57">Analyse 57

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
    +--------------------------------------OBJ:V-N-------------------------------------+                                        |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
    |         +-------COMP:N-N(from)-------+                                           |                                        |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |             |        |                    |                                 |      |       |                      |               |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
OBJ:V-N (bind,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
COMP:N-N(from) (bZIP,protein(s))
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A58">Analyse 58

    +-------------------------------------------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------------------------------------------+                                       
    +----------------OBJ:V-N---------------+                                                                                                                                                                              |                                       
    |         +---------MOD_ATT:N-N--------+                                                                                                            +------------COMP:ADJ-N(with)-----------+                         |                                       
    |         |     +------MOD_ATT:N-N-----+                                                                             +-MOD_ATT:N-ADJ+               |                      +--MOD_ATT:N-ADJ-+                         |           +----COMP:N-N(of)----+      
    |         |     |            +MOD_ATT:N+------------------------------APPOS-----------------------------+            |      +MOD_ATT+-MOD_POST:N-ADJ+                      |        +MOD_ATT+                    +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |     |            |         |                                                                |            |      |       |               |                      |        |       |                    |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,protein(s))
MOD_ATT:N-N (protein(s),bZIP)
MOD_ATT:N-N (protein(s),domain)
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V-N (occur,bind)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A59">Analyse 59

    +-------------------------------------------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------------------------------------------+                                       
    +----------------OBJ:V-N---------------+                                                                                                                                                                              |                                       
    |         +---------MOD_ATT:N-N--------+                                                                                                                   +--------COMP:ADJ-N(with)--------+                         |                                       
    |         |     +------MOD_ATT:N-N-----+                                                                             +-MOD_ATT:N-ADJ+                      |               +--MOD_ATT:N-ADJ-+                         |           +----COMP:N-N(of)----+      
    |         |     |            +MOD_ATT:N+------------------------------APPOS-----------------------------+            |      +MOD_ATT+----MOD_POST:N-ADJ----+               |        +MOD_ATT+                    +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |     |            |         |                                                                |            |      |       |                      |               |        |       |                    |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,protein(s))
MOD_ATT:N-N (protein(s),bZIP)
MOD_ATT:N-N (protein(s),domain)
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V-N (occur,bind)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A60">Analyse 60

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                                                                         +-------------------------------------SUBJ:V-N------------------------------------+                                       
              +-----------------------------COMP:N-N(from)-----------------------------+                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                  +----------MOD_ATT:N-ADJ---------+                    |                                        |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              |                  |         +------MOD_ATT:N-N-----+                    |                                        |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  |         |             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |             |        |                    |                                 |      |       |               |                      |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
COMP:N-N(from) (bZIP,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
MOD_ATT:N-ADJ (fragment,__NODE__)
MOD_ATT:N-N (fragment,protein(s))
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A61">Analyse 61

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                                                                         +-------------------------------------SUBJ:V-N------------------------------------+                                       
              +-----------------------------COMP:N-N(from)-----------------------------+                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                  +----------MOD_ATT:N-ADJ---------+                    |                                        |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              |                  |         +------MOD_ATT:N-N-----+                    |                                        |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  |         |             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |             |        |                    |                                 |      |       |                      |               |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
COMP:N-N(from) (bZIP,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
MOD_ATT:N-ADJ (fragment,__NODE__)
MOD_ATT:N-N (fragment,protein(s))
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A62">Analyse 62

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
                                                                                                                                |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              +-------COMP:N-N(from)-------+                                                                                    |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+------------------------------APPOS-----------------------------+            +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |                                                                |            |      |       |               |                      |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
COMP:N-N(from) (bZIP,protein(s))
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A63">Analyse 63

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
                                                                                                                                |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              +-------COMP:N-N(from)-------+                                                                                    |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+------------------------------APPOS-----------------------------+            +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |                                                                |            |      |       |                      |               |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
COMP:N-N(from) (bZIP,protein(s))
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A64">Analyse 64

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              +-----------------------------COMP:N-N(from)-----------------------------+                                        |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              |                            +----------------MOD_ATT:N-N----------------+                                        |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |             |        |                    |                                 |      |       |               |                      |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
COMP:N-N(from) (bZIP,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,protein(s))
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A65">Analyse 65

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              +-----------------------------COMP:N-N(from)-----------------------------+                                        |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              |                            +----------------MOD_ATT:N-N----------------+                                        |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |             |        |                    |                                 |      |       |                      |               |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
COMP:N-N(from) (bZIP,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,protein(s))
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A66">Analyse 66

    +-------------------------------------------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------------------------------------------+                                       
    |                                                                                                                    +----MOD_ATT:N-ADJ----+                                                                          |                                       
    |                                                                                                                    |      +-MOD_ATT:N-ADJ+                               +--MOD_ATT:N-ADJ-+                         |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+------------------------------APPOS-----------------------------+            |      |       +MOD_AT+MOD_ATT:N-N+                   |        +MOD_ATT+SUBJ:V_+            +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |                                                                |            |      |       |      |           |                   |        |       |       |            |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (gene,mutant)
MOD_ATT:N-ADJ (gene,__SP__)
MOD_ATT:N-ADJ (gene,__NODE__)
MOD_ATT:N-N (G,gene)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
SUBJ:V-N (occur,bind)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A67">Analyse 67

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
    +----------------OBJ:V-N---------------+                                                                                    +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
    |         +---------MOD_ATT:N-N--------+                                                                                    |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
    |         |     +------MOD_ATT:N-N-----+                                                                                    |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    |         |     |            +MOD_ATT:N+------------------------------APPOS-----------------------------+            +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |     |            |         |                                                                |            |      |       |               |                      |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,protein(s))
MOD_ATT:N-N (protein(s),bZIP)
MOD_ATT:N-N (protein(s),domain)
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A68">Analyse 68

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
    +----------------OBJ:V-N---------------+                                                                                    +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
    |         +---------MOD_ATT:N-N--------+                                                                                    |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
    |         |     +------MOD_ATT:N-N-----+                                                                                    |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    |         |     |            +MOD_ATT:N+------------------------------APPOS-----------------------------+            +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |     |            |         |                                                                |            |      |       |                      |               |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,protein(s))
MOD_ATT:N-N (protein(s),bZIP)
MOD_ATT:N-N (protein(s),domain)
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A69">Analyse 69

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                        +------------------------------------------------------COMP:V-N(from)-----------------------------------------------------+                                                
              |                                                                        |                                                +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                                                                        |                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                  +----------MOD_ATT:N-ADJ---------+                    |                                        |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              |                  |         +------MOD_ATT:N-N-----+                    |                                        |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  |         |             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |             |        |                    |                                 |      |       |               |                      |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-ADJ (fragment,__NODE__)
MOD_ATT:N-N (fragment,protein(s))
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A70">Analyse 70

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                        +------------------------------------------------------COMP:V-N(from)-----------------------------------------------------+                                                
              |                                                                        |                                                +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                                                                        |                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                  +----------MOD_ATT:N-ADJ---------+                    |                                        |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              |                  |         +------MOD_ATT:N-N-----+                    |                                        |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  |         |             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |             |        |                    |                                 |      |       |                      |               |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-ADJ (fragment,__NODE__)
MOD_ATT:N-N (fragment,protein(s))
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A71">Analyse 71

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                                                                         +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                                                                                                                 +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              +-----------------------------COMP:N-N(from)-----------------------------+                                        |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              +-------COMP:N-N(from)-------+                                           |                                        |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |             |        |                    |                                 |      |       |               |                      |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
COMP:N-N(from) (bZIP,protein(s))
COMP:N-N(from) (bZIP,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A72">Analyse 72

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                                                                         +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                                                                                                                 +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              +-----------------------------COMP:N-N(from)-----------------------------+                                        |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              +-------COMP:N-N(from)-------+                                           |                                        |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |             |        |                    |                                 |      |       |                      |               |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
COMP:N-N(from) (bZIP,protein(s))
COMP:N-N(from) (bZIP,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A73">Analyse 73

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              +----------------------------------------COMP:N-N(from)---------------------------------------+                   |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              +-------COMP:N-N(from)-------+                                                                |                   |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+                                                                |            +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |                                                                |            |      |       |               |                      |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
COMP:N-N(from) (bZIP,protein(s))
COMP:N-N(from) (bZIP,@card@)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A74">Analyse 74

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                        +-------------------------------------------------------COMP:V-N(of)------------------------------------------------------+                                                
              |                                                                        |                                                +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                                                                        |                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                                                                        |                                        |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              +-------COMP:N-N(from)-------+                                           |                                        |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |             |        |                    |                                 |      |       |               |                      |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
COMP:N-N(from) (bZIP,protein(s))
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(of) (do,bZIP)
COMP:V-N(of) (do,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A75">Analyse 75

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              +----------------------------------------COMP:N-N(from)---------------------------------------+                   |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              +-------COMP:N-N(from)-------+                                                                |                   |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+                                                                |            +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |                                                                |            |      |       |                      |               |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
COMP:N-N(from) (bZIP,protein(s))
COMP:N-N(from) (bZIP,@card@)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A76">Analyse 76

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                        +-------------------------------------------------------COMP:V-N(of)------------------------------------------------------+                                                
              |                                                                        |                                                +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                                                                        |                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                                                                        |                                        |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              +-------COMP:N-N(from)-------+                                           |                                        |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |             |        |                    |                                 |      |       |                      |               |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
COMP:N-N(from) (bZIP,protein(s))
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(of) (do,bZIP)
COMP:V-N(of) (do,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A77">Analyse 77

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                            +----------------------------------------------------------------------------COMP:V-N(from)---------------------------------------------------------------------------+                                                
              |                            |                                           +------------------------------------------------------COMP:V-N(from)-----------------------------------------------------+                                                
              |                            |                                           |                                                +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                            |                                           |                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                            |                                           |                                        |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              |                            |                                           |                                        |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |             |        |                    |                                 |      |       |               |                      |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,protein(s))
COMP:V-N(from) (do,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A78">Analyse 78

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                            +----------------------------------------------------------------------------COMP:V-N(from)---------------------------------------------------------------------------+                                                
              |                            |                                           +------------------------------------------------------COMP:V-N(from)-----------------------------------------------------+                                                
              |                            |                                           |                                                +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                            |                                           |                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                            |                                           |                                        |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              |                            |                                           |                                        |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |             |        |                    |                                 |      |       |                      |               |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,protein(s))
COMP:V-N(from) (do,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A79">Analyse 79

    +------------------------------------------------OBJ:V-N------------------------------------------------+                           +-------------------------------------SUBJ:V-N------------------------------------+                                       
    +----------------OBJ:V-N---------------+                                                                |                   +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
    |         +---------MOD_ATT:N-N--------+                                                                |                   |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
    |         |     +------MOD_ATT:N-N-----+                                                                |                   |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    |         |     |            +MOD_ATT:N+                                                                |            +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |     |            |         |                                                                |            |      |       |               |                      |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,protein(s))
OBJ:V-N (bind,@card@)
MOD_ATT:N-N (protein(s),bZIP)
MOD_ATT:N-N (protein(s),domain)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A80">Analyse 80

    +------------------------------------------------OBJ:V-N------------------------------------------------+                           +-------------------------------------SUBJ:V-N------------------------------------+                                       
    +----------------OBJ:V-N---------------+                                                                |                   +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
    |         +---------MOD_ATT:N-N--------+                                                                |                   |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
    |         |     +------MOD_ATT:N-N-----+                                                                |                   |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    |         |     |            +MOD_ATT:N+                                                                |            +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |     |            |         |                                                                |            |      |       |                      |               |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,protein(s))
OBJ:V-N (bind,@card@)
MOD_ATT:N-N (protein(s),bZIP)
MOD_ATT:N-N (protein(s),domain)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A81">Analyse 81

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
              +-----------------------------COMP:N-N(from)-----------------------------+                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                            +----------------MOD_ATT:N-N----------------+                                        |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              |                  +----------MOD_ATT:N-ADJ---------+                    |                                        |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |             |        |                    |                                 |      |       |               |                      |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
COMP:N-N(from) (bZIP,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (fragment,__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,protein(s))
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A82">Analyse 82

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
              +-----------------------------COMP:N-N(from)-----------------------------+                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                            +----------------MOD_ATT:N-N----------------+                                        |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              |                  +----------MOD_ATT:N-ADJ---------+                    |                                        |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |             |        |                    |                                 |      |       |                      |               |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
COMP:N-N(from) (bZIP,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (fragment,__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,protein(s))
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A83">Analyse 83

    +--------------------------------------OBJ:V-N-------------------------------------+                                                +-------------------------------------SUBJ:V-N------------------------------------+                                       
    +----------------OBJ:V-N---------------+                                           |                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
    |         +---------MOD_ATT:N-N--------+                                           |                                        |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
    |         |     +------MOD_ATT:N-N-----+                                           |                                        |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    |         |     |            +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |     |            |         |             |        |                    |                                 |      |       |               |                      |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,protein(s))
OBJ:V-N (bind,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
MOD_ATT:N-N (protein(s),bZIP)
MOD_ATT:N-N (protein(s),domain)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A84">Analyse 84

    +--------------------------------------OBJ:V-N-------------------------------------+                                                +-------------------------------------SUBJ:V-N------------------------------------+                                       
    +----------------OBJ:V-N---------------+                                           |                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
    |         +---------MOD_ATT:N-N--------+                                           |                                        |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
    |         |     +------MOD_ATT:N-N-----+                                           |                                        |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    |         |     |            +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |     |            |         |             |        |                    |                                 |      |       |                      |               |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,protein(s))
OBJ:V-N (bind,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
MOD_ATT:N-N (protein(s),bZIP)
MOD_ATT:N-N (protein(s),domain)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A85">Analyse 85

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
    +------------------------------------------------OBJ:V-N------------------------------------------------+                   |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
    |         +-------COMP:N-N(from)-------+                                                                |                   |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+                                                                |            +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |                                                                |            |      |       |               |                      |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
OBJ:V-N (bind,@card@)
COMP:N-N(from) (bZIP,protein(s))
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A86">Analyse 86

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                                                                +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
    +------------------------------------------------OBJ:V-N------------------------------------------------+                   |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
    |         +-------COMP:N-N(from)-------+                                                                |                   |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+                                                                |            +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |                                                                |            |      |       |                      |               |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
OBJ:V-N (bind,@card@)
COMP:N-N(from) (bZIP,protein(s))
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A87">Analyse 87

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                                                                         +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                                                                                                                 +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                                                                                                                 |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              +-------COMP:N-N(from)-------+                                                                                    |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+------------------------------APPOS-----------------------------+            +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |                                                                |            |      |       |               |                      |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
COMP:N-N(from) (bZIP,protein(s))
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A88">Analyse 88

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                                                                         +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                                                                                                                 +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                                                                                                                 |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              +-------COMP:N-N(from)-------+                                                                                    |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+------------------------------APPOS-----------------------------+            +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |                                                                |            |      |       |                      |               |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
COMP:N-N(from) (bZIP,protein(s))
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A89">Analyse 89

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                            +----------------------------------------------------------------------------COMP:V-N(from)---------------------------------------------------------------------------+                                                
              |                            |                                                                                            +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                            |                                                                                    +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                            |                                                                                    |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              |                            |                                                                                    |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+------------------------------APPOS-----------------------------+            +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |                                                                |            |      |       |               |                      |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,protein(s))
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A90">Analyse 90

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                                                                         +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                                                                                                                 +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                                                                                                                 |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              +-------COMP:N-N(from)-------+                                                                                    |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+------------------------------APPOS-----------------------------+            +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |                                                                |            |      |       |               |                      |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
COMP:N-N(from) (bZIP,protein(s))
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A91">Analyse 91

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                            +----------------------------------------------------------------------------COMP:V-N(from)---------------------------------------------------------------------------+                                                
              |                            |                                                                                            +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                            |                                                                                    +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                            |                                                                                    |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              |                            |                                                                                    |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+------------------------------APPOS-----------------------------+            +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |                                                                |            |      |       |                      |               |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,protein(s))
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A92">Analyse 92

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                                                                         +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                                                                                                                 +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                                                                                                                 |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              +-------COMP:N-N(from)-------+                                                                                    |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+------------------------------APPOS-----------------------------+            +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |                                                                |            |      |       |                      |               |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
COMP:N-N(from) (bZIP,protein(s))
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A93">Analyse 93

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                                                                         +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                                                                                                                 +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              +-----------------------------COMP:N-N(from)-----------------------------+                                        |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              |                            +----------------MOD_ATT:N-N----------------+                                        |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |             |        |                    |                                 |      |       |               |                      |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
COMP:N-N(from) (bZIP,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,protein(s))
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A94">Analyse 94

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                                                                         +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                                                                                                                 +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              +-----------------------------COMP:N-N(from)-----------------------------+                                        |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              |                            +----------------MOD_ATT:N-N----------------+                                        |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |             |        |                    |                                 |      |       |                      |               |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
COMP:N-N(from) (bZIP,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,protein(s))
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A95">Analyse 95

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                                                                         +-------------------------------------SUBJ:V-N------------------------------------+                                       
              +-----------------------------COMP:N-N(from)-----------------------------+                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                  +----------MOD_ATT:N-ADJ---------+                    |                                        |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              |                  |         +------MOD_ATT:N-N-----+                    |                                        |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  |         |             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |             |        |                    |                                 |      |       |               |                      |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
COMP:N-N(from) (bZIP,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
MOD_ATT:N-ADJ (fragment,__NODE__)
MOD_ATT:N-N (fragment,protein(s))
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A96">Analyse 96

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                                                                         +-------------------------------------SUBJ:V-N------------------------------------+                                       
              +-----------------------------COMP:N-N(from)-----------------------------+                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                  +----------MOD_ATT:N-ADJ---------+                    |                                        |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              |                  |         +------MOD_ATT:N-N-----+                    |                                        |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  |         |             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |             |        |                    |                                 |      |       |                      |               |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
COMP:N-N(from) (bZIP,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
MOD_ATT:N-ADJ (fragment,__NODE__)
MOD_ATT:N-N (fragment,protein(s))
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A97">Analyse 97

    +-------------------------------------------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------------------------------------------+                                       
    |                                                                                                                    +----MOD_ATT:N-ADJ----+                                                                          |                                       
    |         +-------COMP:N-N(from)-------+                                                                             |      +-MOD_ATT:N-ADJ+                               +--MOD_ATT:N-ADJ-+                         |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+------------------------------APPOS-----------------------------+            |      |       +MOD_AT+MOD_ATT:N-N+                   |        +MOD_ATT+SUBJ:V_+            +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |                                                                |            |      |       |      |           |                   |        |       |       |            |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
COMP:N-N(from) (bZIP,protein(s))
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (gene,mutant)
MOD_ATT:N-ADJ (gene,__SP__)
MOD_ATT:N-ADJ (gene,__NODE__)
MOD_ATT:N-N (G,gene)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
SUBJ:V-N (occur,bind)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A98">Analyse 98

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                            +----------------------------------------------------------------------------COMP:V-N(from)---------------------------------------------------------------------------+                                                
              |                            |                                                                                            +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                            |                                                                                    +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                            |                                                                                    |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              |                            |                                                                                    |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+------------------------------APPOS-----------------------------+            +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |                                                                |            |      |       |               |                      |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,protein(s))
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A99">Analyse 99

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                            +----------------------------------------------------------------------------COMP:V-N(from)---------------------------------------------------------------------------+                                                
              |                            |                                                                                            +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                            |                                                                                    +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                            |                                                                                    |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              |                            |                                                                                    |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+------------------------------APPOS-----------------------------+            +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |                                                                |            |      |       |                      |               |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,protein(s))
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A100">Analyse 100

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                        +------------------------------------------------------COMP:V-N(from)-----------------------------------------------------+                                                
              |                                                                        |                                                +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                                                                        |                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                                                                        |                                        |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              |                            +----------------MOD_ATT:N-N----------------+                                        |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |             |        |                    |                                 |      |       |               |                      |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,protein(s))
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A101">Analyse 101

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                        +------------------------------------------------------COMP:V-N(from)-----------------------------------------------------+                                                
              |                                                                        |                                                +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                                                                        |                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                                                                        |                                        |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              |                            +----------------MOD_ATT:N-N----------------+                                        |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |             |        |                    |                                 |      |       |                      |               |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,protein(s))
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A102">Analyse 102

    +-------------------------------------------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------------------------------------------+                                       
    |                                                                                                                    +----MOD_ATT:N-ADJ----+                                                                          |                                       
    |                                                                                                                    |      +-MOD_ATT:N-ADJ+                               +--MOD_ATT:N-ADJ-+                         |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+------------------------------APPOS-----------------------------+            |      |       +MOD_AT+MOD_ATT:N-N+                   |        +MOD_ATT+                    +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |                                                                |            |      |       |      |           |                   |        |       |                    |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (gene,mutant)
MOD_ATT:N-ADJ (gene,__SP__)
MOD_ATT:N-ADJ (gene,__NODE__)
MOD_ATT:N-N (G,gene)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V-N (occur,bind)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A103">Analyse 103

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
    +----------------OBJ:V-N---------------+                                                                                    +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
    |         +---------MOD_ATT:N-N--------+                                                                                    |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
    |         |     +------MOD_ATT:N-N-----+                                                                                    |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    |         |     |            +MOD_ATT:N+------------------------------APPOS-----------------------------+            +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |     |            |         |                                                                |            |      |       |               |                      |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,protein(s))
MOD_ATT:N-N (protein(s),bZIP)
MOD_ATT:N-N (protein(s),domain)
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A104">Analyse 104

                                                                                                                                        +-------------------------------------SUBJ:V-N------------------------------------+                                       
    +----------------OBJ:V-N---------------+                                                                                    +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
    |         +---------MOD_ATT:N-N--------+                                                                                    |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
    |         |     +------MOD_ATT:N-N-----+                                                                                    |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    |         |     |            +MOD_ATT:N+------------------------------APPOS-----------------------------+            +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |     |            |         |                                                                |            |      |       |                      |               |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,protein(s))
MOD_ATT:N-N (protein(s),bZIP)
MOD_ATT:N-N (protein(s),domain)
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A105">Analyse 105

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                        +------------------------------------------------------COMP:V-N(from)-----------------------------------------------------+                                                
              |                                                                        |                                                +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                                                                        |                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                  +----------MOD_ATT:N-ADJ---------+                    |                                        |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              |                  |         +------MOD_ATT:N-N-----+                    |                                        |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  |         |             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |             |        |                    |                                 |      |       |               |                      |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-ADJ (fragment,__NODE__)
MOD_ATT:N-N (fragment,protein(s))
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A106">Analyse 106

                                                                                       +-------------------------------------------------------COMP:V-N(of)------------------------------------------------------+                                                
              +--------------------MOD_ATT:N-N--------------------+                    |                                                +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |     +-----------------MOD_ATT:N-N-----------------+                    |                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |     |            +----------MOD_ATT:N-ADJ---------+                    |                                        |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              |     |            |         +------MOD_ATT:N-N-----+                    |                                        |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |     |            |         |             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |     |            |         |             |        |                    |                                 |      |       |               |                      |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-N (fragment,bZIP)
MOD_ATT:N-N (fragment,domain)
MOD_ATT:N-ADJ (fragment,__NODE__)
MOD_ATT:N-N (fragment,protein(s))
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(of) (do,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A107">Analyse 107

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                        +------------------------------------------------------COMP:V-N(from)-----------------------------------------------------+                                                
              |                                                                        |                                                +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                                                                        |                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                  +----------MOD_ATT:N-ADJ---------+                    |                                        |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              |                  |         +------MOD_ATT:N-N-----+                    |                                        |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  |         |             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |             |        |                    |                                 |      |       |                      |               |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-ADJ (fragment,__NODE__)
MOD_ATT:N-N (fragment,protein(s))
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A108">Analyse 108

                                                                                       +-------------------------------------------------------COMP:V-N(of)------------------------------------------------------+                                                
              +--------------------MOD_ATT:N-N--------------------+                    |                                                +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |     +-----------------MOD_ATT:N-N-----------------+                    |                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |     |            +----------MOD_ATT:N-ADJ---------+                    |                                        |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              |     |            |         +------MOD_ATT:N-N-----+                    |                                        |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |     |            |         |             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |     |            |         |             |        |                    |                                 |      |       |                      |               |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-N (fragment,bZIP)
MOD_ATT:N-N (fragment,domain)
MOD_ATT:N-ADJ (fragment,__NODE__)
MOD_ATT:N-N (fragment,protein(s))
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(of) (do,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A109">Analyse 109

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                                                                         +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                                                                                                                 +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              +----------------------------------------COMP:N-N(from)---------------------------------------+                   |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              +-------COMP:N-N(from)-------+                                                                |                   |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+                                                                |            +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |                                                                |            |      |       |               |                      |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
COMP:N-N(from) (bZIP,protein(s))
COMP:N-N(from) (bZIP,@card@)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A110">Analyse 110

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                                                                         +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                                                                                                                 +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              +----------------------------------------COMP:N-N(from)---------------------------------------+                   |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              +-------COMP:N-N(from)-------+                                                                |                   |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+                                                                |            +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |                                                                |            |      |       |                      |               |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
COMP:N-N(from) (bZIP,protein(s))
COMP:N-N(from) (bZIP,@card@)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A111">Analyse 111

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                                                                         +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                                                                                                                 +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              +-----------------------------COMP:N-N(from)-----------------------------+                                        |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              +-------COMP:N-N(from)-------+                                           |                                        |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |             |        |                    |                                 |      |       |               |                      |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
COMP:N-N(from) (bZIP,protein(s))
COMP:N-N(from) (bZIP,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A112">Analyse 112

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                                                                         +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                                                                                                                 +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              +-----------------------------COMP:N-N(from)-----------------------------+                                        |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              +-------COMP:N-N(from)-------+                                           |                                        |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |             |        |                    |                                 |      |       |                      |               |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
COMP:N-N(from) (bZIP,protein(s))
COMP:N-N(from) (bZIP,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A113">Analyse 113

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                                                                         +-------------------------------------SUBJ:V-N------------------------------------+                                       
              +-----------------------------COMP:N-N(from)-----------------------------+                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                            +----------------MOD_ATT:N-N----------------+                                        |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              |                  +----------MOD_ATT:N-ADJ---------+                    |                                        |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |             |        |                    |                                 |      |       |               |                      |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
COMP:N-N(from) (bZIP,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (fragment,__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,protein(s))
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A114">Analyse 114

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                                                                         +-------------------------------------SUBJ:V-N------------------------------------+                                       
              +-----------------------------COMP:N-N(from)-----------------------------+                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                            +----------------MOD_ATT:N-N----------------+                                        |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              |                  +----------MOD_ATT:N-ADJ---------+                    |                                        |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |             |        |                    |                                 |      |       |                      |               |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
COMP:N-N(from) (bZIP,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (fragment,__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,protein(s))
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A115">Analyse 115

                                           +-----------------------------------------------------------------------------COMP:V-N(of)----------------------------------------------------------------------------+                                                
                                           |                                           +-------------------------------------------------------COMP:V-N(of)------------------------------------------------------+                                                
                                           |                                           |                                                +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                           |                                           |                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              +---------MOD_ATT:N-N--------+                                           |                                        |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              |     +------MOD_ATT:N-N-----+                                           |                                        |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |     |            +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |     |            |         |             |        |                    |                                 |      |       |               |                      |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-N (protein(s),bZIP)
MOD_ATT:N-N (protein(s),domain)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(of) (do,protein(s))
COMP:V-N(of) (do,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A116">Analyse 116

                                           +-----------------------------------------------------------------------------COMP:V-N(of)----------------------------------------------------------------------------+                                                
                                           |                                           +-------------------------------------------------------COMP:V-N(of)------------------------------------------------------+                                                
                                           |                                           |                                                +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                           |                                           |                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              +---------MOD_ATT:N-N--------+                                           |                                        |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              |     +------MOD_ATT:N-N-----+                                           |                                        |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |     |            +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |     |            |         |             |        |                    |                                 |      |       |                      |               |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-N (protein(s),bZIP)
MOD_ATT:N-N (protein(s),domain)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(of) (do,protein(s))
COMP:V-N(of) (do,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A117">Analyse 117

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                                             +--------------------------------------------COMP:V-N(of)--------------------------------------------+                                                
              |                                                                                             |                           +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                                                                                             |                   +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                                                                                             |                   |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              +-------COMP:N-N(from)-------+                                                                |                   |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+                                                                |            +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |                                                                |            |      |       |               |                      |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
COMP:N-N(from) (bZIP,protein(s))
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(of) (do,bZIP)
COMP:V-N(of) (do,@card@)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A118">Analyse 118

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                                             +--------------------------------------------COMP:V-N(of)--------------------------------------------+                                                
              |                                                                                             |                           +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                                                                                             |                   +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                                                                                             |                   |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              +-------COMP:N-N(from)-------+                                                                |                   |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+                                                                |            +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |                                                                |            |      |       |                      |               |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
COMP:N-N(from) (bZIP,protein(s))
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(of) (do,bZIP)
COMP:V-N(of) (do,@card@)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A119">Analyse 119

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                            +----------------------------------------------------------------------------COMP:V-N(from)---------------------------------------------------------------------------+                                                
              |                            |                                                                +-------------------------------------------COMP:V-N(from)-------------------------------------------+                                                
              |                            |                                                                |                           +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                            |                                                                |                   +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                            |                                                                |                   |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              |                            |                                                                |                   |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+                                                                |            +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |                                                                |            |      |       |               |                      |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,protein(s))
COMP:V-N(from) (do,@card@)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A120">Analyse 120

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                            +----------------------------------------------------------------------------COMP:V-N(from)---------------------------------------------------------------------------+                                                
              |                            |                                                                +-------------------------------------------COMP:V-N(from)-------------------------------------------+                                                
              |                            |                                                                |                           +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                            |                                                                |                   +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                            |                                                                |                   |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              |                            |                                                                |                   |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+                                                                |            +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |                                                                |            |      |       |                      |               |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,protein(s))
COMP:V-N(from) (do,@card@)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A121">Analyse 121

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                        +-------------------------------------------------------COMP:V-N(of)------------------------------------------------------+                                                
              |                                                                        |                                                +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                                                                        |                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                                                                        |                                        |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              +-------COMP:N-N(from)-------+                                           |                                        |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |             |        |                    |                                 |      |       |               |                      |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
COMP:N-N(from) (bZIP,protein(s))
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(of) (do,bZIP)
COMP:V-N(of) (do,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A122">Analyse 122

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                        +-------------------------------------------------------COMP:V-N(of)------------------------------------------------------+                                                
              |                                                                        |                                                +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                                                                        |                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                                                                        |                                        |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              +-------COMP:N-N(from)-------+                                           |                                        |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |             |        |                    |                                 |      |       |                      |               |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
COMP:N-N(from) (bZIP,protein(s))
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(of) (do,bZIP)
COMP:V-N(of) (do,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A123">Analyse 123

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                            +----------------------------------------------------------------------------COMP:V-N(from)---------------------------------------------------------------------------+                                                
              |                            |                                           +------------------------------------------------------COMP:V-N(from)-----------------------------------------------------+                                                
              |                            |                                           |                                                +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                            |                                           |                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                            |                                           |                                        |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              |                            |                                           |                                        |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |             |        |                    |                                 |      |       |               |                      |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,protein(s))
COMP:V-N(from) (do,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A124">Analyse 124

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                            +----------------------------------------------------------------------------COMP:V-N(from)---------------------------------------------------------------------------+                                                
              |                            |                                           +------------------------------------------------------COMP:V-N(from)-----------------------------------------------------+                                                
              |                            |                                           |                                                +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                            |                                           |                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                            |                                           |                                        |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              |                            |                                           |                                        |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |             |        |                    |                                 |      |       |                      |               |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,protein(s))
COMP:V-N(from) (do,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A125">Analyse 125

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                        +------------------------------------------------------COMP:V-N(from)-----------------------------------------------------+                                                
              |                                                                        |                                                +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                                                                        |                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                            +----------------MOD_ATT:N-N----------------+                                        |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              |                  +----------MOD_ATT:N-ADJ---------+                    |                                        |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |             |        |                    |                                 |      |       |               |                      |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (fragment,__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,protein(s))
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A126">Analyse 126

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                        +------------------------------------------------------COMP:V-N(from)-----------------------------------------------------+                                                
              |                                                                        |                                                +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                                                                        |                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                            +----------------MOD_ATT:N-N----------------+                                        |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              |                  +----------MOD_ATT:N-ADJ---------+                    |                                        |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |             |        |                    |                                 |      |       |                      |               |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (fragment,__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,protein(s))
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A127">Analyse 127

    +------------------------------------------------OBJ:V-N------------------------------------------------+                           +-------------------------------------SUBJ:V-N------------------------------------+                                       
    +----------------OBJ:V-N---------------+                                                                |                   +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
    |         +---------MOD_ATT:N-N--------+                                                                |                   |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
    |         |     +------MOD_ATT:N-N-----+                                                                |                   |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    |         |     |            +MOD_ATT:N+                                                                |            +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |     |            |         |                                                                |            |      |       |               |                      |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,protein(s))
OBJ:V-N (bind,@card@)
MOD_ATT:N-N (protein(s),bZIP)
MOD_ATT:N-N (protein(s),domain)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A128">Analyse 128

    +------------------------------------------------OBJ:V-N------------------------------------------------+                           +-------------------------------------SUBJ:V-N------------------------------------+                                       
    +----------------OBJ:V-N---------------+                                                                |                   +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
    |         +---------MOD_ATT:N-N--------+                                                                |                   |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
    |         |     +------MOD_ATT:N-N-----+                                                                |                   |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
    |         |     |            +MOD_ATT:N+                                                                |            +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |     |            |         |                                                                |            |      |       |                      |               |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,protein(s))
OBJ:V-N (bind,@card@)
MOD_ATT:N-N (protein(s),bZIP)
MOD_ATT:N-N (protein(s),domain)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A129">Analyse 129

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                                                                         +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                                                                                                                 +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                                                                                                                 |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              +-------COMP:N-N(from)-------+                                                                                    |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+------------------------------APPOS-----------------------------+            +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |                                                                |            |      |       |               |                      |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
COMP:N-N(from) (bZIP,protein(s))
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A130">Analyse 130

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                                                                         +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                                                                                                                 +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                                                                                                                 |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              +-------COMP:N-N(from)-------+                                                                                    |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+------------------------------APPOS-----------------------------+            +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |                                                                |            |      |       |                      |               |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
COMP:N-N(from) (bZIP,protein(s))
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A131">Analyse 131

                                           +-----------------------------------------------------------------------------COMP:V-N(of)----------------------------------------------------------------------------+                                                
                                           |                                                                                            +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                           |                                                                                    +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              +---------MOD_ATT:N-N--------+                                                                                    |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              |     +------MOD_ATT:N-N-----+                                                                                    |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |     |            +MOD_ATT:N+------------------------------APPOS-----------------------------+            +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |     |            |         |                                                                |            |      |       |               |                      |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-N (protein(s),bZIP)
MOD_ATT:N-N (protein(s),domain)
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(of) (do,protein(s))
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A132">Analyse 132

                                           +-----------------------------------------------------------------------------COMP:V-N(of)----------------------------------------------------------------------------+                                                
                                           |                                                                                            +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                           |                                                                                    +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              +---------MOD_ATT:N-N--------+                                                                                    |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              |     +------MOD_ATT:N-N-----+                                                                                    |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |     |            +MOD_ATT:N+------------------------------APPOS-----------------------------+            +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |     |            |         |                                                                |            |      |       |                      |               |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-N (protein(s),bZIP)
MOD_ATT:N-N (protein(s),domain)
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(of) (do,protein(s))
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A133">Analyse 133

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                            +----------------------------------------------------------------------------COMP:V-N(from)---------------------------------------------------------------------------+                                                
              |                            |                                                                                            +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                            |                                                                                    +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                            |                                                                                    |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              |                            |                                                                                    |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+------------------------------APPOS-----------------------------+            +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |                                                                |            |      |       |               |                      |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,protein(s))
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A134">Analyse 134

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                                                                         +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                                                                                                                 +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                                                                                                                 |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              +-------COMP:N-N(from)-------+                                                                                    |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+------------------------------APPOS-----------------------------+            +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |                                                                |            |      |       |               |                      |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
COMP:N-N(from) (bZIP,protein(s))
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A135">Analyse 135

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                            +----------------------------------------------------------------------------COMP:V-N(from)---------------------------------------------------------------------------+                                                
              |                            |                                                                                            +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                            |                                                                                    +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                            |                                                                                    |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              |                            |                                                                                    |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+------------------------------APPOS-----------------------------+            +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |                                                                |            |      |       |                      |               |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,protein(s))
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A136">Analyse 136

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                                                                         +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                                                                                                                 +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                                                                                                                 |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              +-------COMP:N-N(from)-------+                                                                                    |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+------------------------------APPOS-----------------------------+            +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |                                                                |            |      |       |                      |               |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
COMP:N-N(from) (bZIP,protein(s))
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A137">Analyse 137

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                                                                         +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                                                                                                                 +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              +-----------------------------COMP:N-N(from)-----------------------------+                                        |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              |                            +----------------MOD_ATT:N-N----------------+                                        |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |             |        |                    |                                 |      |       |               |                      |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
COMP:N-N(from) (bZIP,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,protein(s))
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A138">Analyse 138

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                                                                         +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                                                                                                                 +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              +-----------------------------COMP:N-N(from)-----------------------------+                                        |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              |                            +----------------MOD_ATT:N-N----------------+                                        |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |             |        |                    |                                 |      |       |                      |               |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
COMP:N-N(from) (bZIP,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,protein(s))
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A139">Analyse 139

                                           +-----------------------------------------------------------------------------COMP:V-N(of)----------------------------------------------------------------------------+                                                
                                           |                                                                                            +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                           |                                                                                    +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              +---------MOD_ATT:N-N--------+                                                                                    |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              |     +------MOD_ATT:N-N-----+                                                                                    |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |     |            +MOD_ATT:N+------------------------------APPOS-----------------------------+            +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |     |            |         |                                                                |            |      |       |               |                      |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-N (protein(s),bZIP)
MOD_ATT:N-N (protein(s),domain)
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(of) (do,protein(s))
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A140">Analyse 140

                                           +-----------------------------------------------------------------------------COMP:V-N(of)----------------------------------------------------------------------------+                                                
                                           |                                                                                            +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                           |                                                                                    +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              +---------MOD_ATT:N-N--------+                                                                                    |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              |     +------MOD_ATT:N-N-----+                                                                                    |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |     |            +MOD_ATT:N+------------------------------APPOS-----------------------------+            +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |     |            |         |                                                                |            |      |       |                      |               |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-N (protein(s),bZIP)
MOD_ATT:N-N (protein(s),domain)
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(of) (do,protein(s))
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A141">Analyse 141

    +-------------------------------------------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------------------------------------------+                                       
    |                                                                                                                    +----MOD_ATT:N-ADJ----+                                                                          |                                       
    |         +-------COMP:N-N(from)-------+                                                                             |      +-MOD_ATT:N-ADJ+                               +--MOD_ATT:N-ADJ-+                         |           +----COMP:N-N(of)----+      
    +-OBJ:V-N-+                  +MOD_ATT:N+------------------------------APPOS-----------------------------+            |      |       +MOD_AT+MOD_ATT:N-N+                   |        +MOD_ATT+                    +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |                  |         |                                                                |            |      |       |      |           |                   |        |       |                    |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,bZIP)
COMP:N-N(from) (bZIP,protein(s))
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (gene,mutant)
MOD_ATT:N-ADJ (gene,__SP__)
MOD_ATT:N-ADJ (gene,__NODE__)
MOD_ATT:N-N (G,gene)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V-N (occur,bind)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A142">Analyse 142

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                            +----------------------------------------------------------------------------COMP:V-N(from)---------------------------------------------------------------------------+                                                
              |                            |                                                                                            +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                            |                                                                                    +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                            |                                                                                    |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              |                            |                                                                                    |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+------------------------------APPOS-----------------------------+            +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |                                                                |            |      |       |               |                      |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,protein(s))
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A143">Analyse 143

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                            +----------------------------------------------------------------------------COMP:V-N(from)---------------------------------------------------------------------------+                                                
              |                            |                                                                                            +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                            |                                                                                    +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                            |                                                                                    |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              |                            |                                                                                    |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+------------------------------APPOS-----------------------------+            +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |                                                                |            |      |       |                      |               |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,protein(s))
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A144">Analyse 144

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                        +------------------------------------------------------COMP:V-N(from)-----------------------------------------------------+                                                
              |                                                                        |                                                +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                                                                        |                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                                                                        |                                        |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              |                            +----------------MOD_ATT:N-N----------------+                                        |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |             |        |                    |                                 |      |       |               |                      |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,protein(s))
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A145">Analyse 145

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                        +------------------------------------------------------COMP:V-N(from)-----------------------------------------------------+                                                
              |                                                                        |                                                +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                                                                        |                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                                                                        |                                        |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              |                            +----------------MOD_ATT:N-N----------------+                                        |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |             |        |                    |                                 |      |       |                      |               |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,protein(s))
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A146">Analyse 146

    +-------------------------------------------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------------------------------------------+                                       
    +----------------OBJ:V-N---------------+                                                                                                                                                                              |                                       
    |         +---------MOD_ATT:N-N--------+                                                                             +----MOD_ATT:N-ADJ----+                                                                          |                                       
    |         |     +------MOD_ATT:N-N-----+                                                                             |      +-MOD_ATT:N-ADJ+                               +--MOD_ATT:N-ADJ-+                         |           +----COMP:N-N(of)----+      
    |         |     |            +MOD_ATT:N+------------------------------APPOS-----------------------------+            |      |       +MOD_AT+MOD_ATT:N-N+                   |        +MOD_ATT+SUBJ:V_+            +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |     |            |         |                                                                |            |      |       |      |           |                   |        |       |       |            |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,protein(s))
MOD_ATT:N-N (protein(s),bZIP)
MOD_ATT:N-N (protein(s),domain)
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (gene,mutant)
MOD_ATT:N-ADJ (gene,__SP__)
MOD_ATT:N-ADJ (gene,__NODE__)
MOD_ATT:N-N (G,gene)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
SUBJ:V-N (occur,bind)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A147">Analyse 147

                                                                                       +-------------------------------------------------------COMP:V-N(of)------------------------------------------------------+                                                
              +--------------------MOD_ATT:N-N--------------------+                    |                                                +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |     +-----------------MOD_ATT:N-N-----------------+                    |                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |     |            +----------MOD_ATT:N-ADJ---------+                    |                                        |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              |     |            |         +------MOD_ATT:N-N-----+                    |                                        |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |     |            |         |             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |     |            |         |             |        |                    |                                 |      |       |               |                      |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-N (fragment,bZIP)
MOD_ATT:N-N (fragment,domain)
MOD_ATT:N-ADJ (fragment,__NODE__)
MOD_ATT:N-N (fragment,protein(s))
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(of) (do,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A148">Analyse 148

                                                                                       +-------------------------------------------------------COMP:V-N(of)------------------------------------------------------+                                                
              +--------------------MOD_ATT:N-N--------------------+                    |                                                +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |     +-----------------MOD_ATT:N-N-----------------+                    |                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |     |            +----------MOD_ATT:N-ADJ---------+                    |                                        |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              |     |            |         +------MOD_ATT:N-N-----+                    |                                        |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |     |            |         |             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |     |            |         |             |        |                    |                                 |      |       |                      |               |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-N (fragment,bZIP)
MOD_ATT:N-N (fragment,domain)
MOD_ATT:N-ADJ (fragment,__NODE__)
MOD_ATT:N-N (fragment,protein(s))
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(of) (do,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A149">Analyse 149

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                                                                         +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                                                                                                                 +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              +----------------------------------------COMP:N-N(from)---------------------------------------+                   |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              +-------COMP:N-N(from)-------+                                                                |                   |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+                                                                |            +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |                                                                |            |      |       |               |                      |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
COMP:N-N(from) (bZIP,protein(s))
COMP:N-N(from) (bZIP,@card@)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A150">Analyse 150

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                                                                         +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                                                                                                                 +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              +----------------------------------------COMP:N-N(from)---------------------------------------+                   |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              +-------COMP:N-N(from)-------+                                                                |                   |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+                                                                |            +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |                                                                |            |      |       |                      |               |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
COMP:N-N(from) (bZIP,protein(s))
COMP:N-N(from) (bZIP,@card@)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A151">Analyse 151

                                           +-----------------------------------------------------------------------------COMP:V-N(of)----------------------------------------------------------------------------+                                                
                                           |                                                                +--------------------------------------------COMP:V-N(of)--------------------------------------------+                                                
                                           |                                                                |                           +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                           |                                                                |                   +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              +---------MOD_ATT:N-N--------+                                                                |                   |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              |     +------MOD_ATT:N-N-----+                                                                |                   |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |     |            +MOD_ATT:N+                                                                |            +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |     |            |         |                                                                |            |      |       |               |                      |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-N (protein(s),bZIP)
MOD_ATT:N-N (protein(s),domain)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(of) (do,protein(s))
COMP:V-N(of) (do,@card@)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A152">Analyse 152

                                           +-----------------------------------------------------------------------------COMP:V-N(of)----------------------------------------------------------------------------+                                                
                                           |                                                                +--------------------------------------------COMP:V-N(of)--------------------------------------------+                                                
                                           |                                                                |                           +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                           |                                                                |                   +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              +---------MOD_ATT:N-N--------+                                                                |                   |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              |     +------MOD_ATT:N-N-----+                                                                |                   |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |     |            +MOD_ATT:N+                                                                |            +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |     |            |         |                                                                |            |      |       |                      |               |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-N (protein(s),bZIP)
MOD_ATT:N-N (protein(s),domain)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(of) (do,protein(s))
COMP:V-N(of) (do,@card@)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A153">Analyse 153

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                                                                         +-------------------------------------SUBJ:V-N------------------------------------+                                       
              +-----------------------------COMP:N-N(from)-----------------------------+                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                            +----------------MOD_ATT:N-N----------------+                                        |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              |                  +----------MOD_ATT:N-ADJ---------+                    |                                        |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |             |        |                    |                                 |      |       |               |                      |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
COMP:N-N(from) (bZIP,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (fragment,__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,protein(s))
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A154">Analyse 154

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                                                                         +-------------------------------------SUBJ:V-N------------------------------------+                                       
              +-----------------------------COMP:N-N(from)-----------------------------+                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                            +----------------MOD_ATT:N-N----------------+                                        |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              |                  +----------MOD_ATT:N-ADJ---------+                    |                                        |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |             |        |                    |                                 |      |       |                      |               |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
COMP:N-N(from) (bZIP,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (fragment,__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,protein(s))
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A155">Analyse 155

                                           +-----------------------------------------------------------------------------COMP:V-N(of)----------------------------------------------------------------------------+                                                
                                           |                                           +-------------------------------------------------------COMP:V-N(of)------------------------------------------------------+                                                
                                           |                                           |                                                +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                           |                                           |                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              +---------MOD_ATT:N-N--------+                                           |                                        |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              |     +------MOD_ATT:N-N-----+                                           |                                        |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |     |            +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |     |            |         |             |        |                    |                                 |      |       |               |                      |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-N (protein(s),bZIP)
MOD_ATT:N-N (protein(s),domain)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(of) (do,protein(s))
COMP:V-N(of) (do,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A156">Analyse 156

                                           +-----------------------------------------------------------------------------COMP:V-N(of)----------------------------------------------------------------------------+                                                
                                           |                                           +-------------------------------------------------------COMP:V-N(of)------------------------------------------------------+                                                
                                           |                                           |                                                +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                           |                                           |                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              +---------MOD_ATT:N-N--------+                                           |                                        |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              |     +------MOD_ATT:N-N-----+                                           |                                        |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |     |            +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |     |            |         |             |        |                    |                                 |      |       |                      |               |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-N (protein(s),bZIP)
MOD_ATT:N-N (protein(s),domain)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(of) (do,protein(s))
COMP:V-N(of) (do,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A157">Analyse 157

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                                             +--------------------------------------------COMP:V-N(of)--------------------------------------------+                                                
              |                                                                                             |                           +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                                                                                             |                   +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                                                                                             |                   |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              +-------COMP:N-N(from)-------+                                                                |                   |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+                                                                |            +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |                                                                |            |      |       |               |                      |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
COMP:N-N(from) (bZIP,protein(s))
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(of) (do,bZIP)
COMP:V-N(of) (do,@card@)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A158">Analyse 158

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                                             +--------------------------------------------COMP:V-N(of)--------------------------------------------+                                                
              |                                                                                             |                           +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                                                                                             |                   +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                                                                                             |                   |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              +-------COMP:N-N(from)-------+                                                                |                   |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+                                                                |            +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |                                                                |            |      |       |                      |               |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
COMP:N-N(from) (bZIP,protein(s))
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(of) (do,bZIP)
COMP:V-N(of) (do,@card@)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A159">Analyse 159

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                            +----------------------------------------------------------------------------COMP:V-N(from)---------------------------------------------------------------------------+                                                
              |                            |                                                                +-------------------------------------------COMP:V-N(from)-------------------------------------------+                                                
              |                            |                                                                |                           +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                            |                                                                |                   +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                            |                                                                |                   |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              |                            |                                                                |                   |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+                                                                |            +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |                                                                |            |      |       |               |                      |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,protein(s))
COMP:V-N(from) (do,@card@)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A160">Analyse 160

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                            +----------------------------------------------------------------------------COMP:V-N(from)---------------------------------------------------------------------------+                                                
              |                            |                                                                +-------------------------------------------COMP:V-N(from)-------------------------------------------+                                                
              |                            |                                                                |                           +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                            |                                                                |                   +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                            |                                                                |                   |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              |                            |                                                                |                   |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+                                                                |            +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |                                                                |            |      |       |                      |               |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,protein(s))
COMP:V-N(from) (do,@card@)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A161">Analyse 161

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                        +------------------------------------------------------COMP:V-N(from)-----------------------------------------------------+                                                
              |                                                                        |                                                +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                                                                        |                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                            +----------------MOD_ATT:N-N----------------+                                        |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              |                  +----------MOD_ATT:N-ADJ---------+                    |                                        |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |             |        |                    |                                 |      |       |               |                      |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (fragment,__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,protein(s))
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A162">Analyse 162

              +-------------------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------------------+                                                
              |                                                                        +------------------------------------------------------COMP:V-N(from)-----------------------------------------------------+                                                
              |                                                                        |                                                +-------------------------------------SUBJ:V-N------------------------------------+                                       
              |                                                                        |                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              |                            +----------------MOD_ATT:N-N----------------+                                        |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              |                  +----------MOD_ATT:N-ADJ---------+                    |                                        |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |                  +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |                  |         |             |        |                    |                                 |      |       |                      |               |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (fragment,__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,protein(s))
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(of) (do,bZIP)
COMP:V-N(from) (do,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A163">Analyse 163

                                                                                       +-------------------------------------------------------COMP:V-N(of)------------------------------------------------------+                                                
                                                                                       |                                                +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                       |                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              +---------MOD_ATT:N-N--------+                                           |                                        |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              |     +------MOD_ATT:N-N-----+----------------MOD_ATT:N-N----------------+                                        |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |     |            +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |     |            |         |             |        |                    |                                 |      |       |               |                      |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-N (protein(s),bZIP)
MOD_ATT:N-N (protein(s),domain)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,protein(s))
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(of) (do,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A164">Analyse 164

                                                                                       +-------------------------------------------------------COMP:V-N(of)------------------------------------------------------+                                                
                                                                                       |                                                +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                       |                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              +---------MOD_ATT:N-N--------+                                           |                                        |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              |     +------MOD_ATT:N-N-----+----------------MOD_ATT:N-N----------------+                                        |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |     |            +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+SUBJ:V_+        |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |     |            |         |             |        |                    |                                 |      |       |                      |               |        |       |       |        |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-N (protein(s),bZIP)
MOD_ATT:N-N (protein(s),domain)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,protein(s))
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V_PASS-N (mutate,element)
COMP:V-N(of) (do,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A165">Analyse 165

                                           +-----------------------------------------------------------------------------COMP:V-N(of)----------------------------------------------------------------------------+                                                
                                           |                                                                                            +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                           |                                                                                    +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              +---------MOD_ATT:N-N--------+                                                                                    |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              |     +------MOD_ATT:N-N-----+                                                                                    |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |     |            +MOD_ATT:N+------------------------------APPOS-----------------------------+            +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |     |            |         |                                                                |            |      |       |               |                      |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-N (protein(s),bZIP)
MOD_ATT:N-N (protein(s),domain)
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(of) (do,protein(s))
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A166">Analyse 166

                                           +-----------------------------------------------------------------------------COMP:V-N(of)----------------------------------------------------------------------------+                                                
                                           |                                                                                            +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                           |                                                                                    +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              +---------MOD_ATT:N-N--------+                                                                                    |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              |     +------MOD_ATT:N-N-----+                                                                                    |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |     |            +MOD_ATT:N+------------------------------APPOS-----------------------------+            +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |     |            |         |                                                                |            |      |       |                      |               |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-N (protein(s),bZIP)
MOD_ATT:N-N (protein(s),domain)
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(of) (do,protein(s))
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A167">Analyse 167

                                           +-----------------------------------------------------------------------------COMP:V-N(of)----------------------------------------------------------------------------+                                                
                                           |                                                                                            +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                           |                                                                                    +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              +---------MOD_ATT:N-N--------+                                                                                    |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              |     +------MOD_ATT:N-N-----+                                                                                    |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |     |            +MOD_ATT:N+------------------------------APPOS-----------------------------+            +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |     |            |         |                                                                |            |      |       |               |                      |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-N (protein(s),bZIP)
MOD_ATT:N-N (protein(s),domain)
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(of) (do,protein(s))
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A168">Analyse 168

                                           +-----------------------------------------------------------------------------COMP:V-N(of)----------------------------------------------------------------------------+                                                
                                           |                                                                                            +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                           |                                                                                    +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              +---------MOD_ATT:N-N--------+                                                                                    |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              |     +------MOD_ATT:N-N-----+                                                                                    |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |     |            +MOD_ATT:N+------------------------------APPOS-----------------------------+            +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |     |            |         |                                                                |            |      |       |                      |               |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-N (protein(s),bZIP)
MOD_ATT:N-N (protein(s),domain)
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(of) (do,protein(s))
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A169">Analyse 169

    +-------------------------------------------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------------------------------------------+                                       
    +----------------OBJ:V-N---------------+                                                                                                                                                                              |                                       
    |         +---------MOD_ATT:N-N--------+                                                                             +----MOD_ATT:N-ADJ----+                                                                          |                                       
    |         |     +------MOD_ATT:N-N-----+                                                                             |      +-MOD_ATT:N-ADJ+                               +--MOD_ATT:N-ADJ-+                         |           +----COMP:N-N(of)----+      
    |         |     |            +MOD_ATT:N+------------------------------APPOS-----------------------------+            |      |       +MOD_AT+MOD_ATT:N-N+                   |        +MOD_ATT+                    +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |         |     |            |         |                                                                |            |      |       |      |           |                   |        |       |                    |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
OBJ:V-N (bind,protein(s))
MOD_ATT:N-N (protein(s),bZIP)
MOD_ATT:N-N (protein(s),domain)
MOD_ATT:N-ADJ (protein(s),__NODE__)
APPOS (protein(s),@card@)
MOD_ATT:N-ADJ (gene,mutant)
MOD_ATT:N-ADJ (gene,__SP__)
MOD_ATT:N-ADJ (gene,__NODE__)
MOD_ATT:N-N (G,gene)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
SUBJ:V-N (occur,bind)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A170">Analyse 170

                                           +-----------------------------------------------------------------------------COMP:V-N(of)----------------------------------------------------------------------------+                                                
                                           |                                                                +--------------------------------------------COMP:V-N(of)--------------------------------------------+                                                
                                           |                                                                |                           +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                           |                                                                |                   +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              +---------MOD_ATT:N-N--------+                                                                |                   |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              |     +------MOD_ATT:N-N-----+                                                                |                   |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |     |            +MOD_ATT:N+                                                                |            +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |     |            |         |                                                                |            |      |       |               |                      |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-N (protein(s),bZIP)
MOD_ATT:N-N (protein(s),domain)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(of) (do,protein(s))
COMP:V-N(of) (do,@card@)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A171">Analyse 171

                                           +-----------------------------------------------------------------------------COMP:V-N(of)----------------------------------------------------------------------------+                                                
                                           |                                                                +--------------------------------------------COMP:V-N(of)--------------------------------------------+                                                
                                           |                                                                |                           +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                           |                                                                |                   +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              +---------MOD_ATT:N-N--------+                                                                |                   |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              |     +------MOD_ATT:N-N-----+                                                                |                   |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |     |            +MOD_ATT:N+                                                                |            +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |     |            |         |                                                                |            |      |       |                      |               |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-N (protein(s),bZIP)
MOD_ATT:N-N (protein(s),domain)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(of) (do,protein(s))
COMP:V-N(of) (do,@card@)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A172">Analyse 172

                                                                                       +-------------------------------------------------------COMP:V-N(of)------------------------------------------------------+                                                
                                                                                       |                                                +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                       |                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              +---------MOD_ATT:N-N--------+                                           |                                        |       |               +------------COMP:ADJ-N(with)-----------+                |        |                                       
              |     +------MOD_ATT:N-N-----+----------------MOD_ATT:N-N----------------+                                        |       |               |                      +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |     |            +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +-MOD_POST:N-ADJ+                      |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |     |            |         |             |        |                    |                                 |      |       |               |                      |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-N (protein(s),bZIP)
MOD_ATT:N-N (protein(s),domain)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,protein(s))
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,248T)
COMP:ADJ-N(with) (248T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(of) (do,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

name="reponse" value="A173">Analyse 173

                                                                                       +-------------------------------------------------------COMP:V-N(of)------------------------------------------------------+                                                
                                                                                       |                                                +-------------------------------------SUBJ:V-N------------------------------------+                                       
                                                                                       |                                        +---------------------------------COMP:V-N(from)---------------------------------+        |                                       
              +---------MOD_ATT:N-N--------+                                           |                                        |       |                      +--------COMP:ADJ-N(with)--------+                |        |                                       
              |     +------MOD_ATT:N-N-----+----------------MOD_ATT:N-N----------------+                                        |       |                      |               +--MOD_ATT:N-ADJ-+                |        |           +----COMP:N-N(of)----+      
              |     |            +MOD_ATT:N+             +MOD_ATT:+-----MOD_ATT:N-N----+                                 +MOD_AT+       +----MOD_POST:N-ADJ----+               |        +MOD_ATT+                |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
              |     |            |         |             |        |                    |                                 |      |       |                      |               |        |       |                |   |    |           |          |         |      
 Binding of bZIP domain from __NODE__ protein(s) and promoter fragment ( GCCCAAGGCCCCGCTGATTCGATGTAGGC 265 237 ) from mutant __SP__ __NODE__ gene ( C 248T G 247T with its __NODE__ response element mutated ) does not occur in a system of purified components .
MOD_ATT:N-N (protein(s),bZIP)
MOD_ATT:N-N (protein(s),domain)
MOD_ATT:N-ADJ (protein(s),__NODE__)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,protein(s))
MOD_ATT:N-N (GCCCAAGGCCCCGCTGATTCGATGTAGGC,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
MOD_POST:N-ADJ (__NODE__,247T)
COMP:ADJ-N(with) (247T,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:V-N(of) (do,GCCCAAGGCCCCGCTGATTCGATGTAGGC)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)