Binding of double stranded __NODE__ Vitamin D response element ( 5 ' AGCTTAAGAGGTCAGAAAGGTCACTCGCAT 3 ' and a protein fragment ( 613 752 ) containing a LXXLL motif 1 2 3 from __NODE__ protein and a protein protein complex consisting of mutant __NODE__ ( allele rxr443 ) ( deletion with its AF 2 transcription activation domain deleted ) and of __NODE__ and vitamin D occurs in a system of purified components .