Validation pour Ingenuity034

vers la météo de la validation par utilisateur

Ingenuity034

precedent - 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 - suivant

Phrase 78 - PMID ?

Binding of heterodimer consisting of NODE and of NODE and RARE ( 5 ' GGCCAGAGGTCAAGGCTAGA 3 ' from Oct 3/4 [NODE] gene occurs in cell extract from Cos 1 cells .

Non annotée
Je ne sais pas
Je n'ai pas trouvé d'analyse satisfaisante

Commentaires :

Analyse 0

    +-------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------+                                     
    |                        +-------------------------------------------COMP:V-N(from)------------------------------------------+     |                                     
    |                        +-----------------------------COMP:N-N(of)----------------------------+                             |     +---------COMP:V-N(from)---------+    
    |                        +--------COMP:N-N(of)--------+                                        |                             |     +-COMP:V-N(in)-+                 |    
    +COMP:N-N(of)+--SUBJ:V-N-+COMP:N-N(of)+               |                                        |                     +MOD_ATT+     |        +MOD_A+             +MOD+    
    |            |           |            |               |                                        |                     |       |     |        |     |             |   |    
 Binding of heterodimer consisting of __NODE__ and of __NODE__ and RARE ( 5 ' GGCCAGAGGTCAAGGCTAGA 3 ' from Oct 3/4 [__NODE__] gene occurs in cell extract from Cos 1 cells .
COMP:N-N(of) (bind,heterodimer)
SUBJ:V-N (consist,heterodimer)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,3)
COMP:V-N(from) (consist,gene)
MOD_ATT:N-N (gene,[__NODE__])
SUBJ:V-N (occur,bind)
COMP:V-N(in) (occur,extract)
COMP:V-N(from) (occur,cell)
MOD_ATT:N-N (extract,cell)
MOD_ATT:N-N (cell,1)

Analyse 1

    +-------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------+                                     
    |                        +-------------------------------------------COMP:V-N(from)------------------------------------------+     +---------COMP:V-N(from)---------+    
    |                        +-----------------------------COMP:N-N(of)----------------------------+                             |     +-COMP:V-N(in)-+                 |    
    +COMP:N-N(of)+--SUBJ:V-N-+COMP:N-N(of)+--COMP:N-N(of)-+                                        |                     +MOD_ATT+     |        +MOD_A+             +MOD+    
    |            |           |            |               |                                        |                     |       |     |        |     |             |   |    
 Binding of heterodimer consisting of __NODE__ and of __NODE__ and RARE ( 5 ' GGCCAGAGGTCAAGGCTAGA 3 ' from Oct 3/4 [__NODE__] gene occurs in cell extract from Cos 1 cells .
COMP:N-N(of) (bind,heterodimer)
SUBJ:V-N (consist,heterodimer)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,3)
COMP:V-N(from) (consist,gene)
COMP:N-N(of) (__NODE__,__NODE__)
MOD_ATT:N-N (gene,[__NODE__])
SUBJ:V-N (occur,bind)
COMP:V-N(in) (occur,extract)
COMP:V-N(from) (occur,cell)
MOD_ATT:N-N (extract,cell)
MOD_ATT:N-N (cell,1)

Analyse 2

    +-------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------+                                     
    |                        +-------------------------------------------COMP:V-N(from)------------------------------------------+     |                                     
    |                        +-----------------------------COMP:N-N(of)----------------------------+                             |     +---------COMP:V-N(from)---------+    
    +--------SUBJ:V-N--------+--------COMP:N-N(of)--------+                                        |                             |     +-COMP:V-N(in)-+                 |    
    +COMP:N-N(of)+           +COMP:N-N(of)+               |                                        |                     +MOD_ATT+     |        +MOD_A+             +MOD+    
    |            |           |            |               |                                        |                     |       |     |        |     |             |   |    
 Binding of heterodimer consisting of __NODE__ and of __NODE__ and RARE ( 5 ' GGCCAGAGGTCAAGGCTAGA 3 ' from Oct 3/4 [__NODE__] gene occurs in cell extract from Cos 1 cells .
COMP:N-N(of) (bind,heterodimer)
SUBJ:V-N (consist,bind)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,3)
COMP:V-N(from) (consist,gene)
MOD_ATT:N-N (gene,[__NODE__])
SUBJ:V-N (occur,bind)
COMP:V-N(in) (occur,extract)
COMP:V-N(from) (occur,cell)
MOD_ATT:N-N (extract,cell)
MOD_ATT:N-N (cell,1)

Analyse 3

    +-------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------+                                     
    |                        +-------------------------------------------COMP:V-N(from)------------------------------------------+     +---------COMP:V-N(from)---------+    
    +--------SUBJ:V-N--------+-----------------------------COMP:N-N(of)----------------------------+                             |     +-COMP:V-N(in)-+                 |    
    +COMP:N-N(of)+           +COMP:N-N(of)+--COMP:N-N(of)-+                                        |                     +MOD_ATT+     |        +MOD_A+             +MOD+    
    |            |           |            |               |                                        |                     |       |     |        |     |             |   |    
 Binding of heterodimer consisting of __NODE__ and of __NODE__ and RARE ( 5 ' GGCCAGAGGTCAAGGCTAGA 3 ' from Oct 3/4 [__NODE__] gene occurs in cell extract from Cos 1 cells .
COMP:N-N(of) (bind,heterodimer)
SUBJ:V-N (consist,bind)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,3)
COMP:V-N(from) (consist,gene)
COMP:N-N(of) (__NODE__,__NODE__)
MOD_ATT:N-N (gene,[__NODE__])
SUBJ:V-N (occur,bind)
COMP:V-N(in) (occur,extract)
COMP:V-N(from) (occur,cell)
MOD_ATT:N-N (extract,cell)
MOD_ATT:N-N (cell,1)

Analyse 4

    +-------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------+                                     
    |                        +-------------------------------------------COMP:V-N(from)------------------------------------------+     +---------COMP:V-N(from)---------+    
    |                        |            +----------------------COMP:N-N(of)----------------------+                             |     +-COMP:V-N(in)-+                 |    
    +COMP:N-N(of)+--SUBJ:V-N-+COMP:N-N(of)+--COMP:N-N(of)-+                                        |                     +MOD_ATT+     |        +MOD_A+             +MOD+    
    |            |           |            |               |                                        |                     |       |     |        |     |             |   |    
 Binding of heterodimer consisting of __NODE__ and of __NODE__ and RARE ( 5 ' GGCCAGAGGTCAAGGCTAGA 3 ' from Oct 3/4 [__NODE__] gene occurs in cell extract from Cos 1 cells .
COMP:N-N(of) (bind,heterodimer)
SUBJ:V-N (consist,heterodimer)
COMP:N-N(of) (consist,__NODE__)
COMP:V-N(from) (consist,gene)
COMP:N-N(of) (__NODE__,__NODE__)
COMP:N-N(of) (__NODE__,3)
MOD_ATT:N-N (gene,[__NODE__])
SUBJ:V-N (occur,bind)
COMP:V-N(in) (occur,extract)
COMP:V-N(from) (occur,cell)
MOD_ATT:N-N (extract,cell)
MOD_ATT:N-N (cell,1)

Analyse 5

    +-------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------+                                     
    |                        +-------------------------------------------COMP:V-N(from)------------------------------------------+     +---------COMP:V-N(from)---------+    
    +--------SUBJ:V-N--------+            +----------------------COMP:N-N(of)----------------------+                             |     +-COMP:V-N(in)-+                 |    
    +COMP:N-N(of)+           +COMP:N-N(of)+--COMP:N-N(of)-+                                        |                     +MOD_ATT+     |        +MOD_A+             +MOD+    
    |            |           |            |               |                                        |                     |       |     |        |     |             |   |    
 Binding of heterodimer consisting of __NODE__ and of __NODE__ and RARE ( 5 ' GGCCAGAGGTCAAGGCTAGA 3 ' from Oct 3/4 [__NODE__] gene occurs in cell extract from Cos 1 cells .
COMP:N-N(of) (bind,heterodimer)
SUBJ:V-N (consist,bind)
COMP:N-N(of) (consist,__NODE__)
COMP:V-N(from) (consist,gene)
COMP:N-N(of) (__NODE__,__NODE__)
COMP:N-N(of) (__NODE__,3)
MOD_ATT:N-N (gene,[__NODE__])
SUBJ:V-N (occur,bind)
COMP:V-N(in) (occur,extract)
COMP:V-N(from) (occur,cell)
MOD_ATT:N-N (extract,cell)
MOD_ATT:N-N (cell,1)

Analyse 6

    +-------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------+                                     
    |                        +-------------------------------------------COMP:V-N(from)------------------------------------------+     |                                     
    |                        +-----------------------------COMP:N-N(of)----------------------------+                             |     +---------COMP:V-N(from)---------+    
    |                        +--------COMP:N-N(of)--------+                                        |                             |     +-COMP:V-N(in)-+                 |    
    +COMP:N-N(of)+--SUBJ:V-N-+COMP:N-N(of)+               |                                        |                     +MOD_ATT+     |        +MOD_A+             +MOD+    
    |            |           |            |               |                                        |                     |       |     |        |     |             |   |    
 Binding of heterodimer consisting of __NODE__ and of __NODE__ and RARE ( 5 ' GGCCAGAGGTCAAGGCTAGA 3 ' from Oct 3/4 [__NODE__] gene occurs in cell extract from Cos 1 cells .
COMP:N-N(of) (bind,heterodimer)
SUBJ:V-N (consist,heterodimer)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,3)
COMP:V-N(from) (consist,gene)
MOD_ATT:N-N (gene,[__NODE__])
SUBJ:V-N (occur,bind)
COMP:V-N(in) (occur,extract)
COMP:V-N(from) (occur,cell)
MOD_ATT:N-N (extract,cell)
MOD_ATT:N-N (cell,1)

Analyse 7

    +-------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------+                                     
    |                        +-------------------------------------------COMP:V-N(from)------------------------------------------+     |                                     
    |                        +-----------------------------COMP:N-N(of)----------------------------+                             |     +---------COMP:V-N(from)---------+    
    +--------SUBJ:V-N--------+--------COMP:N-N(of)--------+                                        |                             |     +-COMP:V-N(in)-+                 |    
    +COMP:N-N(of)+           +COMP:N-N(of)+               |                                        |                     +MOD_ATT+     |        +MOD_A+             +MOD+    
    |            |           |            |               |                                        |                     |       |     |        |     |             |   |    
 Binding of heterodimer consisting of __NODE__ and of __NODE__ and RARE ( 5 ' GGCCAGAGGTCAAGGCTAGA 3 ' from Oct 3/4 [__NODE__] gene occurs in cell extract from Cos 1 cells .
COMP:N-N(of) (bind,heterodimer)
SUBJ:V-N (consist,bind)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,3)
COMP:V-N(from) (consist,gene)
MOD_ATT:N-N (gene,[__NODE__])
SUBJ:V-N (occur,bind)
COMP:V-N(in) (occur,extract)
COMP:V-N(from) (occur,cell)
MOD_ATT:N-N (extract,cell)
MOD_ATT:N-N (cell,1)

Analyse 8

    +-------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------+                                     
    |                        +-------------------------------------------COMP:V-N(from)------------------------------------------+     |                                     
    |                        +-----------------------------COMP:N-N(of)----------------------------+                             |     |                                     
    |                        +--------COMP:N-N(of)--------+                                        |                             |     +-COMP:V-N(in)-+--COMP:N-N(from)-+    
    +COMP:N-N(of)+--SUBJ:V-N-+COMP:N-N(of)+               |                                        |                     +MOD_ATT+     |        +MOD_A+             +MOD+    
    |            |           |            |               |                                        |                     |       |     |        |     |             |   |    
 Binding of heterodimer consisting of __NODE__ and of __NODE__ and RARE ( 5 ' GGCCAGAGGTCAAGGCTAGA 3 ' from Oct 3/4 [__NODE__] gene occurs in cell extract from Cos 1 cells .
COMP:N-N(of) (bind,heterodimer)
SUBJ:V-N (consist,heterodimer)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,3)
COMP:V-N(from) (consist,gene)
MOD_ATT:N-N (gene,[__NODE__])
SUBJ:V-N (occur,bind)
COMP:V-N(in) (occur,extract)
MOD_ATT:N-N (extract,cell)
COMP:N-N(from) (extract,cell)
MOD_ATT:N-N (cell,1)

Analyse 9

    +-------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------+                                     
    |                        +-------------------------------------------COMP:V-N(from)------------------------------------------+     |                                     
    |                        +-----------------------------COMP:N-N(of)----------------------------+                             |     +-COMP:V-N(in)-+--COMP:N-N(from)-+    
    +COMP:N-N(of)+--SUBJ:V-N-+COMP:N-N(of)+--COMP:N-N(of)-+                                        |                     +MOD_ATT+     |        +MOD_A+             +MOD+    
    |            |           |            |               |                                        |                     |       |     |        |     |             |   |    
 Binding of heterodimer consisting of __NODE__ and of __NODE__ and RARE ( 5 ' GGCCAGAGGTCAAGGCTAGA 3 ' from Oct 3/4 [__NODE__] gene occurs in cell extract from Cos 1 cells .
COMP:N-N(of) (bind,heterodimer)
SUBJ:V-N (consist,heterodimer)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,3)
COMP:V-N(from) (consist,gene)
COMP:N-N(of) (__NODE__,__NODE__)
MOD_ATT:N-N (gene,[__NODE__])
SUBJ:V-N (occur,bind)
COMP:V-N(in) (occur,extract)
MOD_ATT:N-N (extract,cell)
COMP:N-N(from) (extract,cell)
MOD_ATT:N-N (cell,1)

Analyse 10

    +-------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------+                                     
    |                        +-------------------------------------------COMP:V-N(from)------------------------------------------+     |                                     
    |                        +-----------------------------COMP:N-N(of)----------------------------+                             |     |                                     
    +--------SUBJ:V-N--------+--------COMP:N-N(of)--------+                                        |                             |     +-COMP:V-N(in)-+--COMP:N-N(from)-+    
    +COMP:N-N(of)+           +COMP:N-N(of)+               |                                        |                     +MOD_ATT+     |        +MOD_A+             +MOD+    
    |            |           |            |               |                                        |                     |       |     |        |     |             |   |    
 Binding of heterodimer consisting of __NODE__ and of __NODE__ and RARE ( 5 ' GGCCAGAGGTCAAGGCTAGA 3 ' from Oct 3/4 [__NODE__] gene occurs in cell extract from Cos 1 cells .
COMP:N-N(of) (bind,heterodimer)
SUBJ:V-N (consist,bind)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,3)
COMP:V-N(from) (consist,gene)
MOD_ATT:N-N (gene,[__NODE__])
SUBJ:V-N (occur,bind)
COMP:V-N(in) (occur,extract)
MOD_ATT:N-N (extract,cell)
COMP:N-N(from) (extract,cell)
MOD_ATT:N-N (cell,1)

Analyse 11

    +-------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------+                                     
    |                        +-------------------------------------------COMP:V-N(from)------------------------------------------+     |                                     
    +--------SUBJ:V-N--------+-----------------------------COMP:N-N(of)----------------------------+                             |     +-COMP:V-N(in)-+--COMP:N-N(from)-+    
    +COMP:N-N(of)+           +COMP:N-N(of)+--COMP:N-N(of)-+                                        |                     +MOD_ATT+     |        +MOD_A+             +MOD+    
    |            |           |            |               |                                        |                     |       |     |        |     |             |   |    
 Binding of heterodimer consisting of __NODE__ and of __NODE__ and RARE ( 5 ' GGCCAGAGGTCAAGGCTAGA 3 ' from Oct 3/4 [__NODE__] gene occurs in cell extract from Cos 1 cells .
COMP:N-N(of) (bind,heterodimer)
SUBJ:V-N (consist,bind)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,3)
COMP:V-N(from) (consist,gene)
COMP:N-N(of) (__NODE__,__NODE__)
MOD_ATT:N-N (gene,[__NODE__])
SUBJ:V-N (occur,bind)
COMP:V-N(in) (occur,extract)
MOD_ATT:N-N (extract,cell)
COMP:N-N(from) (extract,cell)
MOD_ATT:N-N (cell,1)

Analyse 12

    +-------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------+                                     
    |                        +-------------------------------------------COMP:V-N(from)------------------------------------------+     |                                     
    |                        |            +----------------------COMP:N-N(of)----------------------+                             |     +-COMP:V-N(in)-+--COMP:N-N(from)-+    
    +COMP:N-N(of)+--SUBJ:V-N-+COMP:N-N(of)+--COMP:N-N(of)-+                                        |                     +MOD_ATT+     |        +MOD_A+             +MOD+    
    |            |           |            |               |                                        |                     |       |     |        |     |             |   |    
 Binding of heterodimer consisting of __NODE__ and of __NODE__ and RARE ( 5 ' GGCCAGAGGTCAAGGCTAGA 3 ' from Oct 3/4 [__NODE__] gene occurs in cell extract from Cos 1 cells .
COMP:N-N(of) (bind,heterodimer)
SUBJ:V-N (consist,heterodimer)
COMP:N-N(of) (consist,__NODE__)
COMP:V-N(from) (consist,gene)
COMP:N-N(of) (__NODE__,__NODE__)
COMP:N-N(of) (__NODE__,3)
MOD_ATT:N-N (gene,[__NODE__])
SUBJ:V-N (occur,bind)
COMP:V-N(in) (occur,extract)
MOD_ATT:N-N (extract,cell)
COMP:N-N(from) (extract,cell)
MOD_ATT:N-N (cell,1)

Analyse 13

    +-------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------+                                     
    |                        +-------------------------------------------COMP:V-N(from)------------------------------------------+     |                                     
    +--------SUBJ:V-N--------+            +----------------------COMP:N-N(of)----------------------+                             |     +-COMP:V-N(in)-+--COMP:N-N(from)-+    
    +COMP:N-N(of)+           +COMP:N-N(of)+--COMP:N-N(of)-+                                        |                     +MOD_ATT+     |        +MOD_A+             +MOD+    
    |            |           |            |               |                                        |                     |       |     |        |     |             |   |    
 Binding of heterodimer consisting of __NODE__ and of __NODE__ and RARE ( 5 ' GGCCAGAGGTCAAGGCTAGA 3 ' from Oct 3/4 [__NODE__] gene occurs in cell extract from Cos 1 cells .
COMP:N-N(of) (bind,heterodimer)
SUBJ:V-N (consist,bind)
COMP:N-N(of) (consist,__NODE__)
COMP:V-N(from) (consist,gene)
COMP:N-N(of) (__NODE__,__NODE__)
COMP:N-N(of) (__NODE__,3)
MOD_ATT:N-N (gene,[__NODE__])
SUBJ:V-N (occur,bind)
COMP:V-N(in) (occur,extract)
MOD_ATT:N-N (extract,cell)
COMP:N-N(from) (extract,cell)
MOD_ATT:N-N (cell,1)

Analyse 14

    +-------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------+                                     
    |                        +-------------------------------------------COMP:V-N(from)------------------------------------------+     |                                     
    |                        +-----------------------------COMP:N-N(of)----------------------------+                             |     |                                     
    |                        +--------COMP:N-N(of)--------+                                        |                             |     +-COMP:V-N(in)-+--COMP:N-N(from)-+    
    +COMP:N-N(of)+--SUBJ:V-N-+COMP:N-N(of)+               |                                        |                     +MOD_ATT+     |        +MOD_A+             +MOD+    
    |            |           |            |               |                                        |                     |       |     |        |     |             |   |    
 Binding of heterodimer consisting of __NODE__ and of __NODE__ and RARE ( 5 ' GGCCAGAGGTCAAGGCTAGA 3 ' from Oct 3/4 [__NODE__] gene occurs in cell extract from Cos 1 cells .
COMP:N-N(of) (bind,heterodimer)
SUBJ:V-N (consist,heterodimer)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,3)
COMP:V-N(from) (consist,gene)
MOD_ATT:N-N (gene,[__NODE__])
SUBJ:V-N (occur,bind)
COMP:V-N(in) (occur,extract)
MOD_ATT:N-N (extract,cell)
COMP:N-N(from) (extract,cell)
MOD_ATT:N-N (cell,1)

Analyse 15

    +-------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------+                                     
    |                        +-------------------------------------------COMP:V-N(from)------------------------------------------+     |                                     
    |                        +-----------------------------COMP:N-N(of)----------------------------+                             |     |                                     
    +--------SUBJ:V-N--------+--------COMP:N-N(of)--------+                                        |                             |     +-COMP:V-N(in)-+--COMP:N-N(from)-+    
    +COMP:N-N(of)+           +COMP:N-N(of)+               |                                        |                     +MOD_ATT+     |        +MOD_A+             +MOD+    
    |            |           |            |               |                                        |                     |       |     |        |     |             |   |    
 Binding of heterodimer consisting of __NODE__ and of __NODE__ and RARE ( 5 ' GGCCAGAGGTCAAGGCTAGA 3 ' from Oct 3/4 [__NODE__] gene occurs in cell extract from Cos 1 cells .
COMP:N-N(of) (bind,heterodimer)
SUBJ:V-N (consist,bind)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,3)
COMP:V-N(from) (consist,gene)
MOD_ATT:N-N (gene,[__NODE__])
SUBJ:V-N (occur,bind)
COMP:V-N(in) (occur,extract)
MOD_ATT:N-N (extract,cell)
COMP:N-N(from) (extract,cell)
MOD_ATT:N-N (cell,1)

Analyse 16

    +-------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------+                                     
    |                        +-------------------------------------------COMP:V-N(from)------------------------------------------+     |                                     
    |                        +-----------------------------COMP:N-N(of)----------------------------+                             |     +---------COMP:V-N(from)---------+    
    |                        +--------COMP:N-N(of)--------+                                        |                             |     +-COMP:V-N(in)-+                 |    
    +COMP:N-N(of)+--SUBJ:V-N-+COMP:N-N(of)+               |                                        |                     +MOD_ATT+     |        +MOD_A+             +MOD+    
    |            |           |            |               |                                        |                     |       |     |        |     |             |   |    
 Binding of heterodimer consisting of __NODE__ and of __NODE__ and RARE ( 5 ' GGCCAGAGGTCAAGGCTAGA 3 ' from Oct 3/4 [__NODE__] gene occurs in cell extract from Cos 1 cells .
COMP:N-N(of) (bind,heterodimer)
SUBJ:V-N (consist,heterodimer)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,3)
COMP:V-N(from) (consist,gene)
MOD_ATT:N-N (gene,[__NODE__])
SUBJ:V-N (occur,bind)
COMP:V-N(in) (occur,extract)
COMP:V-N(from) (occur,cell)
MOD_ATT:N-N (extract,cell)
MOD_ATT:N-N (cell,1)

Analyse 17

    +-------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------+                                     
    |                        +-------------------------------------------COMP:V-N(from)------------------------------------------+     +---------COMP:V-N(from)---------+    
    |                        +-----------------------------COMP:N-N(of)----------------------------+                             |     +-COMP:V-N(in)-+                 |    
    +COMP:N-N(of)+--SUBJ:V-N-+COMP:N-N(of)+--COMP:N-N(of)-+                                        |                     +MOD_ATT+     |        +MOD_A+             +MOD+    
    |            |           |            |               |                                        |                     |       |     |        |     |             |   |    
 Binding of heterodimer consisting of __NODE__ and of __NODE__ and RARE ( 5 ' GGCCAGAGGTCAAGGCTAGA 3 ' from Oct 3/4 [__NODE__] gene occurs in cell extract from Cos 1 cells .
COMP:N-N(of) (bind,heterodimer)
SUBJ:V-N (consist,heterodimer)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,3)
COMP:V-N(from) (consist,gene)
COMP:N-N(of) (__NODE__,__NODE__)
MOD_ATT:N-N (gene,[__NODE__])
SUBJ:V-N (occur,bind)
COMP:V-N(in) (occur,extract)
COMP:V-N(from) (occur,cell)
MOD_ATT:N-N (extract,cell)
MOD_ATT:N-N (cell,1)

Analyse 18

    +-------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------+                                     
    |                        +-------------------------------------------COMP:V-N(from)------------------------------------------+     |                                     
    |                        +-----------------------------COMP:N-N(of)----------------------------+                             |     +---------COMP:V-N(from)---------+    
    +--------SUBJ:V-N--------+--------COMP:N-N(of)--------+                                        |                             |     +-COMP:V-N(in)-+                 |    
    +COMP:N-N(of)+           +COMP:N-N(of)+               |                                        |                     +MOD_ATT+     |        +MOD_A+             +MOD+    
    |            |           |            |               |                                        |                     |       |     |        |     |             |   |    
 Binding of heterodimer consisting of __NODE__ and of __NODE__ and RARE ( 5 ' GGCCAGAGGTCAAGGCTAGA 3 ' from Oct 3/4 [__NODE__] gene occurs in cell extract from Cos 1 cells .
COMP:N-N(of) (bind,heterodimer)
SUBJ:V-N (consist,bind)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,3)
COMP:V-N(from) (consist,gene)
MOD_ATT:N-N (gene,[__NODE__])
SUBJ:V-N (occur,bind)
COMP:V-N(in) (occur,extract)
COMP:V-N(from) (occur,cell)
MOD_ATT:N-N (extract,cell)
MOD_ATT:N-N (cell,1)

Analyse 19

    +-------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------+                                     
    |                        +-------------------------------------------COMP:V-N(from)------------------------------------------+     +---------COMP:V-N(from)---------+    
    +--------SUBJ:V-N--------+-----------------------------COMP:N-N(of)----------------------------+                             |     +-COMP:V-N(in)-+                 |    
    +COMP:N-N(of)+           +COMP:N-N(of)+--COMP:N-N(of)-+                                        |                     +MOD_ATT+     |        +MOD_A+             +MOD+    
    |            |           |            |               |                                        |                     |       |     |        |     |             |   |    
 Binding of heterodimer consisting of __NODE__ and of __NODE__ and RARE ( 5 ' GGCCAGAGGTCAAGGCTAGA 3 ' from Oct 3/4 [__NODE__] gene occurs in cell extract from Cos 1 cells .
COMP:N-N(of) (bind,heterodimer)
SUBJ:V-N (consist,bind)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,3)
COMP:V-N(from) (consist,gene)
COMP:N-N(of) (__NODE__,__NODE__)
MOD_ATT:N-N (gene,[__NODE__])
SUBJ:V-N (occur,bind)
COMP:V-N(in) (occur,extract)
COMP:V-N(from) (occur,cell)
MOD_ATT:N-N (extract,cell)
MOD_ATT:N-N (cell,1)

Analyse 20

    +-------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------+                                     
    |                        +-------------------------------------------COMP:V-N(from)------------------------------------------+     +---------COMP:V-N(from)---------+    
    |                        |            +----------------------COMP:N-N(of)----------------------+                             |     +-COMP:V-N(in)-+                 |    
    +COMP:N-N(of)+--SUBJ:V-N-+COMP:N-N(of)+--COMP:N-N(of)-+                                        |                     +MOD_ATT+     |        +MOD_A+             +MOD+    
    |            |           |            |               |                                        |                     |       |     |        |     |             |   |    
 Binding of heterodimer consisting of __NODE__ and of __NODE__ and RARE ( 5 ' GGCCAGAGGTCAAGGCTAGA 3 ' from Oct 3/4 [__NODE__] gene occurs in cell extract from Cos 1 cells .
COMP:N-N(of) (bind,heterodimer)
SUBJ:V-N (consist,heterodimer)
COMP:N-N(of) (consist,__NODE__)
COMP:V-N(from) (consist,gene)
COMP:N-N(of) (__NODE__,__NODE__)
COMP:N-N(of) (__NODE__,3)
MOD_ATT:N-N (gene,[__NODE__])
SUBJ:V-N (occur,bind)
COMP:V-N(in) (occur,extract)
COMP:V-N(from) (occur,cell)
MOD_ATT:N-N (extract,cell)
MOD_ATT:N-N (cell,1)

Analyse 21

    +-------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------+                                     
    |                        +-------------------------------------------COMP:V-N(from)------------------------------------------+     +---------COMP:V-N(from)---------+    
    +--------SUBJ:V-N--------+            +----------------------COMP:N-N(of)----------------------+                             |     +-COMP:V-N(in)-+                 |    
    +COMP:N-N(of)+           +COMP:N-N(of)+--COMP:N-N(of)-+                                        |                     +MOD_ATT+     |        +MOD_A+             +MOD+    
    |            |           |            |               |                                        |                     |       |     |        |     |             |   |    
 Binding of heterodimer consisting of __NODE__ and of __NODE__ and RARE ( 5 ' GGCCAGAGGTCAAGGCTAGA 3 ' from Oct 3/4 [__NODE__] gene occurs in cell extract from Cos 1 cells .
COMP:N-N(of) (bind,heterodimer)
SUBJ:V-N (consist,bind)
COMP:N-N(of) (consist,__NODE__)
COMP:V-N(from) (consist,gene)
COMP:N-N(of) (__NODE__,__NODE__)
COMP:N-N(of) (__NODE__,3)
MOD_ATT:N-N (gene,[__NODE__])
SUBJ:V-N (occur,bind)
COMP:V-N(in) (occur,extract)
COMP:V-N(from) (occur,cell)
MOD_ATT:N-N (extract,cell)
MOD_ATT:N-N (cell,1)

Analyse 22

    +-------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------+                                     
    +--------------------------------------------OBJ:V-N-------------------------------------------+                                   +---------COMP:V-N(from)---------+    
    +---------OBJ:V-N--------+--------COMP:N-N(of)--------+                                        |                                   +-COMP:V-N(in)-+                 |    
    |            +MOD_ATT:N-A+COMP:N-N(of)+               |                                        |                     +MOD_ATT+     |        +MOD_A+             +MOD+    
    |            |           |            |               |                                        |                     |       |     |        |     |             |   |    
 Binding of heterodimer consisting of __NODE__ and of __NODE__ and RARE ( 5 ' GGCCAGAGGTCAAGGCTAGA 3 ' from Oct 3/4 [__NODE__] gene occurs in cell extract from Cos 1 cells .
OBJ:V-N (bind,consist)
OBJ:V-N (bind,3)
MOD_ATT:N-ADJ (consist,heterodimer)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (gene,[__NODE__])
SUBJ:V-N (occur,bind)
COMP:V-N(in) (occur,extract)
COMP:V-N(from) (occur,cell)
MOD_ATT:N-N (extract,cell)
MOD_ATT:N-N (cell,1)

Analyse 23

    +-------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------+                                     
    |                        +-------------------------------------------COMP:V-N(from)------------------------------------------+     |                                     
    |                        +-----------------------------COMP:N-N(of)----------------------------+                             |     +---------COMP:V-N(from)---------+    
    |                        +--------COMP:N-N(of)--------+                                        |                             |     +-COMP:V-N(in)-+                 |    
    +COMP:N-N(of)+--SUBJ:V-N-+COMP:N-N(of)+               |                                        |                     +MOD_ATT+     |        +MOD_A+             +MOD+    
    |            |           |            |               |                                        |                     |       |     |        |     |             |   |    
 Binding of heterodimer consisting of __NODE__ and of __NODE__ and RARE ( 5 ' GGCCAGAGGTCAAGGCTAGA 3 ' from Oct 3/4 [__NODE__] gene occurs in cell extract from Cos 1 cells .
COMP:N-N(of) (bind,heterodimer)
SUBJ:V-N (consist,heterodimer)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,3)
COMP:V-N(from) (consist,gene)
MOD_ATT:N-N (gene,[__NODE__])
SUBJ:V-N (occur,bind)
COMP:V-N(in) (occur,extract)
COMP:V-N(from) (occur,cell)
MOD_ATT:N-N (extract,cell)
MOD_ATT:N-N (cell,1)

Analyse 24

    +-------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------+                                     
    |                        +-------------------------------------------COMP:V-N(from)------------------------------------------+     |                                     
    |                        +-----------------------------COMP:N-N(of)----------------------------+                             |     +---------COMP:V-N(from)---------+    
    +--------SUBJ:V-N--------+--------COMP:N-N(of)--------+                                        |                             |     +-COMP:V-N(in)-+                 |    
    +COMP:N-N(of)+           +COMP:N-N(of)+               |                                        |                     +MOD_ATT+     |        +MOD_A+             +MOD+    
    |            |           |            |               |                                        |                     |       |     |        |     |             |   |    
 Binding of heterodimer consisting of __NODE__ and of __NODE__ and RARE ( 5 ' GGCCAGAGGTCAAGGCTAGA 3 ' from Oct 3/4 [__NODE__] gene occurs in cell extract from Cos 1 cells .
COMP:N-N(of) (bind,heterodimer)
SUBJ:V-N (consist,bind)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,3)
COMP:V-N(from) (consist,gene)
MOD_ATT:N-N (gene,[__NODE__])
SUBJ:V-N (occur,bind)
COMP:V-N(in) (occur,extract)
COMP:V-N(from) (occur,cell)
MOD_ATT:N-N (extract,cell)
MOD_ATT:N-N (cell,1)

Analyse 25

    +-------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------+                                     
    |                        +-----------------------------COMP:N-N(of)----------------------------+                                   +---------COMP:V-N(from)---------+    
    +---------OBJ:V-N--------+--------COMP:N-N(of)--------+                                        |                                   +-COMP:V-N(in)-+                 |    
    |            +MOD_ATT:N-A+COMP:N-N(of)+               |                                        |                     +MOD_ATT+     |        +MOD_A+             +MOD+    
    |            |           |            |               |                                        |                     |       |     |        |     |             |   |    
 Binding of heterodimer consisting of __NODE__ and of __NODE__ and RARE ( 5 ' GGCCAGAGGTCAAGGCTAGA 3 ' from Oct 3/4 [__NODE__] gene occurs in cell extract from Cos 1 cells .
OBJ:V-N (bind,consist)
MOD_ATT:N-ADJ (consist,heterodimer)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,3)
MOD_ATT:N-N (gene,[__NODE__])
SUBJ:V-N (occur,bind)
COMP:V-N(in) (occur,extract)
COMP:V-N(from) (occur,cell)
MOD_ATT:N-N (extract,cell)
MOD_ATT:N-N (cell,1)

Analyse 26

    +-------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------+                                     
    |                        +-------------------------------------------COMP:V-N(from)------------------------------------------+     |                                     
    |                        +-----------------------------COMP:N-N(of)----------------------------+                             |     |                                     
    |                        +--------COMP:N-N(of)--------+                                        |                             |     +-COMP:V-N(in)-+--COMP:N-N(from)-+    
    +COMP:N-N(of)+--SUBJ:V-N-+COMP:N-N(of)+               |                                        |                     +MOD_ATT+     |        +MOD_A+             +MOD+    
    |            |           |            |               |                                        |                     |       |     |        |     |             |   |    
 Binding of heterodimer consisting of __NODE__ and of __NODE__ and RARE ( 5 ' GGCCAGAGGTCAAGGCTAGA 3 ' from Oct 3/4 [__NODE__] gene occurs in cell extract from Cos 1 cells .
COMP:N-N(of) (bind,heterodimer)
SUBJ:V-N (consist,heterodimer)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,3)
COMP:V-N(from) (consist,gene)
MOD_ATT:N-N (gene,[__NODE__])
SUBJ:V-N (occur,bind)
COMP:V-N(in) (occur,extract)
MOD_ATT:N-N (extract,cell)
COMP:N-N(from) (extract,cell)
MOD_ATT:N-N (cell,1)

Analyse 27

    +-------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------+                                     
    |                        +-------------------------------------------COMP:V-N(from)------------------------------------------+     |                                     
    |                        +-----------------------------COMP:N-N(of)----------------------------+                             |     +-COMP:V-N(in)-+--COMP:N-N(from)-+    
    +COMP:N-N(of)+--SUBJ:V-N-+COMP:N-N(of)+--COMP:N-N(of)-+                                        |                     +MOD_ATT+     |        +MOD_A+             +MOD+    
    |            |           |            |               |                                        |                     |       |     |        |     |             |   |    
 Binding of heterodimer consisting of __NODE__ and of __NODE__ and RARE ( 5 ' GGCCAGAGGTCAAGGCTAGA 3 ' from Oct 3/4 [__NODE__] gene occurs in cell extract from Cos 1 cells .
COMP:N-N(of) (bind,heterodimer)
SUBJ:V-N (consist,heterodimer)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,3)
COMP:V-N(from) (consist,gene)
COMP:N-N(of) (__NODE__,__NODE__)
MOD_ATT:N-N (gene,[__NODE__])
SUBJ:V-N (occur,bind)
COMP:V-N(in) (occur,extract)
MOD_ATT:N-N (extract,cell)
COMP:N-N(from) (extract,cell)
MOD_ATT:N-N (cell,1)

Analyse 28

    +-------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------+                                     
    |                        +-------------------------------------------COMP:V-N(from)------------------------------------------+     |                                     
    |                        +-----------------------------COMP:N-N(of)----------------------------+                             |     |                                     
    +--------SUBJ:V-N--------+--------COMP:N-N(of)--------+                                        |                             |     +-COMP:V-N(in)-+--COMP:N-N(from)-+    
    +COMP:N-N(of)+           +COMP:N-N(of)+               |                                        |                     +MOD_ATT+     |        +MOD_A+             +MOD+    
    |            |           |            |               |                                        |                     |       |     |        |     |             |   |    
 Binding of heterodimer consisting of __NODE__ and of __NODE__ and RARE ( 5 ' GGCCAGAGGTCAAGGCTAGA 3 ' from Oct 3/4 [__NODE__] gene occurs in cell extract from Cos 1 cells .
COMP:N-N(of) (bind,heterodimer)
SUBJ:V-N (consist,bind)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,3)
COMP:V-N(from) (consist,gene)
MOD_ATT:N-N (gene,[__NODE__])
SUBJ:V-N (occur,bind)
COMP:V-N(in) (occur,extract)
MOD_ATT:N-N (extract,cell)
COMP:N-N(from) (extract,cell)
MOD_ATT:N-N (cell,1)

Analyse 29

    +-------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------+                                     
    |                        +-------------------------------------------COMP:V-N(from)------------------------------------------+     |                                     
    +--------SUBJ:V-N--------+-----------------------------COMP:N-N(of)----------------------------+                             |     +-COMP:V-N(in)-+--COMP:N-N(from)-+    
    +COMP:N-N(of)+           +COMP:N-N(of)+--COMP:N-N(of)-+                                        |                     +MOD_ATT+     |        +MOD_A+             +MOD+    
    |            |           |            |               |                                        |                     |       |     |        |     |             |   |    
 Binding of heterodimer consisting of __NODE__ and of __NODE__ and RARE ( 5 ' GGCCAGAGGTCAAGGCTAGA 3 ' from Oct 3/4 [__NODE__] gene occurs in cell extract from Cos 1 cells .
COMP:N-N(of) (bind,heterodimer)
SUBJ:V-N (consist,bind)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,3)
COMP:V-N(from) (consist,gene)
COMP:N-N(of) (__NODE__,__NODE__)
MOD_ATT:N-N (gene,[__NODE__])
SUBJ:V-N (occur,bind)
COMP:V-N(in) (occur,extract)
MOD_ATT:N-N (extract,cell)
COMP:N-N(from) (extract,cell)
MOD_ATT:N-N (cell,1)

Analyse 30

    +-------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------+                                     
    |                        +-------------------------------------------COMP:V-N(from)------------------------------------------+     |                                     
    |                        |            +----------------------COMP:N-N(of)----------------------+                             |     +-COMP:V-N(in)-+--COMP:N-N(from)-+    
    +COMP:N-N(of)+--SUBJ:V-N-+COMP:N-N(of)+--COMP:N-N(of)-+                                        |                     +MOD_ATT+     |        +MOD_A+             +MOD+    
    |            |           |            |               |                                        |                     |       |     |        |     |             |   |    
 Binding of heterodimer consisting of __NODE__ and of __NODE__ and RARE ( 5 ' GGCCAGAGGTCAAGGCTAGA 3 ' from Oct 3/4 [__NODE__] gene occurs in cell extract from Cos 1 cells .
COMP:N-N(of) (bind,heterodimer)
SUBJ:V-N (consist,heterodimer)
COMP:N-N(of) (consist,__NODE__)
COMP:V-N(from) (consist,gene)
COMP:N-N(of) (__NODE__,__NODE__)
COMP:N-N(of) (__NODE__,3)
MOD_ATT:N-N (gene,[__NODE__])
SUBJ:V-N (occur,bind)
COMP:V-N(in) (occur,extract)
MOD_ATT:N-N (extract,cell)
COMP:N-N(from) (extract,cell)
MOD_ATT:N-N (cell,1)

Analyse 31

    +-------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------+                                     
    |                        +-------------------------------------------COMP:V-N(from)------------------------------------------+     |                                     
    +--------SUBJ:V-N--------+            +----------------------COMP:N-N(of)----------------------+                             |     +-COMP:V-N(in)-+--COMP:N-N(from)-+    
    +COMP:N-N(of)+           +COMP:N-N(of)+--COMP:N-N(of)-+                                        |                     +MOD_ATT+     |        +MOD_A+             +MOD+    
    |            |           |            |               |                                        |                     |       |     |        |     |             |   |    
 Binding of heterodimer consisting of __NODE__ and of __NODE__ and RARE ( 5 ' GGCCAGAGGTCAAGGCTAGA 3 ' from Oct 3/4 [__NODE__] gene occurs in cell extract from Cos 1 cells .
COMP:N-N(of) (bind,heterodimer)
SUBJ:V-N (consist,bind)
COMP:N-N(of) (consist,__NODE__)
COMP:V-N(from) (consist,gene)
COMP:N-N(of) (__NODE__,__NODE__)
COMP:N-N(of) (__NODE__,3)
MOD_ATT:N-N (gene,[__NODE__])
SUBJ:V-N (occur,bind)
COMP:V-N(in) (occur,extract)
MOD_ATT:N-N (extract,cell)
COMP:N-N(from) (extract,cell)
MOD_ATT:N-N (cell,1)

Analyse 32

    +-------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------+                                     
    +--------------------------------------------OBJ:V-N-------------------------------------------+                                   |                                     
    +---------OBJ:V-N--------+--------COMP:N-N(of)--------+                                        |                                   +-COMP:V-N(in)-+--COMP:N-N(from)-+    
    |            +MOD_ATT:N-A+COMP:N-N(of)+               |                                        |                     +MOD_ATT+     |        +MOD_A+             +MOD+    
    |            |           |            |               |                                        |                     |       |     |        |     |             |   |    
 Binding of heterodimer consisting of __NODE__ and of __NODE__ and RARE ( 5 ' GGCCAGAGGTCAAGGCTAGA 3 ' from Oct 3/4 [__NODE__] gene occurs in cell extract from Cos 1 cells .
OBJ:V-N (bind,consist)
OBJ:V-N (bind,3)
MOD_ATT:N-ADJ (consist,heterodimer)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (gene,[__NODE__])
SUBJ:V-N (occur,bind)
COMP:V-N(in) (occur,extract)
MOD_ATT:N-N (extract,cell)
COMP:N-N(from) (extract,cell)
MOD_ATT:N-N (cell,1)

Analyse 33

    +-------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------+                                     
    |                        +-------------------------------------------COMP:V-N(from)------------------------------------------+     |                                     
    |                        +-----------------------------COMP:N-N(of)----------------------------+                             |     |                                     
    |                        +--------COMP:N-N(of)--------+                                        |                             |     +-COMP:V-N(in)-+--COMP:N-N(from)-+    
    +COMP:N-N(of)+--SUBJ:V-N-+COMP:N-N(of)+               |                                        |                     +MOD_ATT+     |        +MOD_A+             +MOD+    
    |            |           |            |               |                                        |                     |       |     |        |     |             |   |    
 Binding of heterodimer consisting of __NODE__ and of __NODE__ and RARE ( 5 ' GGCCAGAGGTCAAGGCTAGA 3 ' from Oct 3/4 [__NODE__] gene occurs in cell extract from Cos 1 cells .
COMP:N-N(of) (bind,heterodimer)
SUBJ:V-N (consist,heterodimer)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,3)
COMP:V-N(from) (consist,gene)
MOD_ATT:N-N (gene,[__NODE__])
SUBJ:V-N (occur,bind)
COMP:V-N(in) (occur,extract)
MOD_ATT:N-N (extract,cell)
COMP:N-N(from) (extract,cell)
MOD_ATT:N-N (cell,1)

Analyse 34

    +-------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------+                                     
    |                        +-------------------------------------------COMP:V-N(from)------------------------------------------+     |                                     
    |                        +-----------------------------COMP:N-N(of)----------------------------+                             |     |                                     
    +--------SUBJ:V-N--------+--------COMP:N-N(of)--------+                                        |                             |     +-COMP:V-N(in)-+--COMP:N-N(from)-+    
    +COMP:N-N(of)+           +COMP:N-N(of)+               |                                        |                     +MOD_ATT+     |        +MOD_A+             +MOD+    
    |            |           |            |               |                                        |                     |       |     |        |     |             |   |    
 Binding of heterodimer consisting of __NODE__ and of __NODE__ and RARE ( 5 ' GGCCAGAGGTCAAGGCTAGA 3 ' from Oct 3/4 [__NODE__] gene occurs in cell extract from Cos 1 cells .
COMP:N-N(of) (bind,heterodimer)
SUBJ:V-N (consist,bind)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,3)
COMP:V-N(from) (consist,gene)
MOD_ATT:N-N (gene,[__NODE__])
SUBJ:V-N (occur,bind)
COMP:V-N(in) (occur,extract)
MOD_ATT:N-N (extract,cell)
COMP:N-N(from) (extract,cell)
MOD_ATT:N-N (cell,1)

Analyse 35

    +-------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------+                                     
    |                        +-----------------------------COMP:N-N(of)----------------------------+                                   |                                     
    +---------OBJ:V-N--------+--------COMP:N-N(of)--------+                                        |                                   +-COMP:V-N(in)-+--COMP:N-N(from)-+    
    |            +MOD_ATT:N-A+COMP:N-N(of)+               |                                        |                     +MOD_ATT+     |        +MOD_A+             +MOD+    
    |            |           |            |               |                                        |                     |       |     |        |     |             |   |    
 Binding of heterodimer consisting of __NODE__ and of __NODE__ and RARE ( 5 ' GGCCAGAGGTCAAGGCTAGA 3 ' from Oct 3/4 [__NODE__] gene occurs in cell extract from Cos 1 cells .
OBJ:V-N (bind,consist)
MOD_ATT:N-ADJ (consist,heterodimer)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,3)
MOD_ATT:N-N (gene,[__NODE__])
SUBJ:V-N (occur,bind)
COMP:V-N(in) (occur,extract)
MOD_ATT:N-N (extract,cell)
COMP:N-N(from) (extract,cell)
MOD_ATT:N-N (cell,1)