Binding of mutant promoter fragment ( G 1977T G 1976C with its Vitamin D response element mutated ) from __SP__ NAPI 3 [__NODE__] gene consisting of Vitamin D response element ( 5 ' GATCAGGGGCAGCAAGGGCAGAAATG 3 ' and a heterodimeric protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a nuclear fraction from Cos 7 cells .