In a nuclear fraction from Cos 7 cells , binding of mutant promoter fragment ( C 1979A A 1978C with its Vitamin D response element mutated ) from __SP__ NAPI 3 [__NODE__] gene consisting of Vitamin D response element ( 5 ' GATCAGGGGCAGCAAGGGCAGAAATG 3 ' and a heterodimeric protein protein complex consisting of __SP__ __NODE__ and of __NODE__ is the same as binding of promoter fragment from __SP__ NAPI 3 [__NODE__] gene consisting of Vitamin D response element ( 5 ' GATCAGGGGCAGCAAGGGCAGAAATG 3 ' and a heterodimeric protein protein complex consisting of __SP__ __NODE__ and of __NODE__ .