Validation pour Ingenuity419

vers la météo de la validation par utilisateur

Ingenuity419

precedent - 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 - suivant

Phrase 81 - PMID ?

SP NODE protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from SP NODE gene and SP NODE protein .

name="reponse" value="NA"> Non annotée
name="reponse" value="JSP"> Je ne sais pas
name="reponse" value="INS"> Je n'ai pas trouvé d'analyse satisfaisante

Commentaires :

<?php echo $Com ; ?>

name="reponse" value="A0">Analyse 0

                                                                                                +-------------------------------COMP:V-N(from)------------------------------+     
                                                                                                |                                  +--------------MOD_ATT:N-ADJ-------------+     
    +---------OBJ:V-N--------+-----------------------------SUBJ:V-N-----------------------------+--------OBJ:V-N--------+          |       +----------MOD_ATT:N-ADJ---------+     
    |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                       |           +MOD_ATT:N-N+          |       |                +-MOD_ATT:N-ADJ-+     
    |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          |       |                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
OBJ:V-N (__SP__,decrease)
MOD_ATT:N-ADJ (decrease,__NODE__)
MOD_ATT:N-N (decrease,protein)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A1">Analyse 1

                                                                                                +-------------------------------COMP:V-N(from)------------------------------+     
                                                                                                |                                  +--------------MOD_ATT:N-ADJ-------------+     
    +---------OBJ:V-N--------+-----------------------------SUBJ:V-N-----------------------------+--------OBJ:V-N--------+          |       +----------MOD_ATT:N-ADJ---------+     
    |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                       |           +MOD_ATT:N-N+          |       |                +-MOD_ATT:N-ADJ-+     
    |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          |       |                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
OBJ:V-N (__SP__,decrease)
MOD_ATT:N-ADJ (decrease,__NODE__)
MOD_ATT:N-N (decrease,protein)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A2">Analyse 2

                             +-----------------------------------------------------------SUBJ:V-N-----------------------------------------------------------+                     
                             +---------------------------------------------------SUBJ:V-N--------------------------------------------------+                |                     
                             |                                                                  +----------COMP:V-N(from)----------+       |                |                     
    +------MOD_ATT:N-ADJ-----+-----------------------------SUBJ:V-N-----------------------------+--------OBJ:V-N--------+          |       +-------------OBJ:V-N------------+     
    |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                       |           +MOD_ATT:N-N+          |       |                +----OBJ:V-N----+     
    |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          |       |                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (decrease,__SP__)
MOD_ATT:N-ADJ (decrease,__NODE__)
MOD_ATT:N-N (decrease,protein)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
COMP:V-N(from) (contain,__SP__)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)
SUBJ:V-N (__SP__,decrease)
OBJ:V-N (__SP__,protein)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A3">Analyse 3

                             +-----------------------------------------------------------SUBJ:V-N-----------------------------------------------------------+                     
                             +---------------------------------------------------SUBJ:V-N--------------------------------------------------+                |                     
                             |                                                                  +----------COMP:V-N(from)----------+       |                |                     
    +------MOD_ATT:N-ADJ-----+-----------------------------SUBJ:V-N-----------------------------+--------OBJ:V-N--------+          |       +-------------OBJ:V-N------------+     
    |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                       |           +MOD_ATT:N-N+          |       |                +----OBJ:V-N----+     
    |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          |       |                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (decrease,__SP__)
MOD_ATT:N-ADJ (decrease,__NODE__)
MOD_ATT:N-N (decrease,protein)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
COMP:V-N(from) (contain,__SP__)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)
SUBJ:V-N (__SP__,decrease)
OBJ:V-N (__SP__,protein)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A4">Analyse 4

                                                                                                                                   +--------------MOD_ATT:N-ADJ-------------+     
    +---------OBJ:V-N--------+-----------------------------SUBJ:V-N-----------------------------+--------OBJ:V-N--------+          |       +----------MOD_ATT:N-ADJ---------+     
    |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                       |           +MOD_ATT:N-N+          |       |                +-MOD_ATT:N-ADJ-+     
    |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          |       |                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
OBJ:V-N (__SP__,decrease)
MOD_ATT:N-ADJ (decrease,__NODE__)
MOD_ATT:N-N (decrease,protein)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A5">Analyse 5

                                                                                                                                   +--------------MOD_ATT:N-ADJ-------------+     
    +---------OBJ:V-N--------+-----------------------------SUBJ:V-N-----------------------------+--------OBJ:V-N--------+          |       +----------MOD_ATT:N-ADJ---------+     
    |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                       |           +MOD_ATT:N-N+          |       |                +-MOD_ATT:N-ADJ-+     
    |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          |       |                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
OBJ:V-N (__SP__,decrease)
MOD_ATT:N-ADJ (decrease,__NODE__)
MOD_ATT:N-N (decrease,protein)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A6">Analyse 6

                             +---------------------------------------------------------------SUBJ:V-N---------------------------------------------------------------+             
                             |                                                                  +-----------------------COMP:V-N(from)----------------------+       |             
                             |                                                                  +--------------COMP:V-N(from)--------------+                |       |             
    +------MOD_ATT:N-ADJ-----+-----------------------------SUBJ:V-N-----------------------------+--------OBJ:V-N--------+                  |                |       |             
    |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                       |           +MOD_ATT:N-N+          +------MOD_ATT:N-ADJ-----+       |             
    |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +OBJ:V-N+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (decrease,__SP__)
MOD_ATT:N-ADJ (decrease,__NODE__)
MOD_ATT:N-N (decrease,protein)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
COMP:V-N(from) (contain,__NODE__)
COMP:V-N(from) (contain,__SP__)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (__SP__,__SP__)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

name="reponse" value="A7">Analyse 7

                             +---------------------------------------------------------------SUBJ:V-N---------------------------------------------------------------+             
                             |                                                                  +-----------------------COMP:V-N(from)----------------------+       |             
                             |                                                                  +--------------COMP:V-N(from)--------------+                |       |             
    +------MOD_ATT:N-ADJ-----+-----------------------------SUBJ:V-N-----------------------------+--------OBJ:V-N--------+                  |                |       |             
    |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                       |           +MOD_ATT:N-N+          +------MOD_ATT:N-ADJ-----+       |             
    |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +OBJ:V-N+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (decrease,__SP__)
MOD_ATT:N-ADJ (decrease,__NODE__)
MOD_ATT:N-N (decrease,protein)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
COMP:V-N(from) (contain,__NODE__)
COMP:V-N(from) (contain,__SP__)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (__SP__,__SP__)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

name="reponse" value="A8">Analyse 8

                             +---------------------------------------------------------------SUBJ:V-N---------------------------------------------------------------+             
                             |                                                                  +-----------------------COMP:V-N(from)----------------------+       |             
    +------MOD_ATT:N-ADJ-----+-----------------------------SUBJ:V-N-----------------------------+--------OBJ:V-N--------+          +------MOD_ATT:N-ADJ-----+       |             
    |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                       |           +MOD_ATT:N-N+          |       +--MOD_ATT:N-ADJ-+       |             
    |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          |       |      +MOD_ATT:N+       +OBJ:V-N+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |      |         |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (decrease,__SP__)
MOD_ATT:N-ADJ (decrease,__NODE__)
MOD_ATT:N-N (decrease,protein)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
COMP:V-N(from) (contain,__SP__)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__SP__,__SP__)
MOD_ATT:N-ADJ (__SP__,__NODE__)
MOD_ATT:N-N (__SP__,gene)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

name="reponse" value="A9">Analyse 9

                             +---------------------------------------------------------------SUBJ:V-N---------------------------------------------------------------+             
                             |                                                                  +-----------------------COMP:V-N(from)----------------------+       |             
    +------MOD_ATT:N-ADJ-----+-----------------------------SUBJ:V-N-----------------------------+--------OBJ:V-N--------+          +------MOD_ATT:N-ADJ-----+       |             
    |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                       |           +MOD_ATT:N-N+          |       +--MOD_ATT:N-ADJ-+       |             
    |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          |       |      +MOD_ATT:N+       +OBJ:V-N+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |      |         |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (decrease,__SP__)
MOD_ATT:N-ADJ (decrease,__NODE__)
MOD_ATT:N-N (decrease,protein)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
COMP:V-N(from) (contain,__SP__)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__SP__,__SP__)
MOD_ATT:N-ADJ (__SP__,__NODE__)
MOD_ATT:N-N (__SP__,gene)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

name="reponse" value="A10">Analyse 10

                                                                                                +-------------------------------COMP:V-N(from)------------------------------+     
                                                                                                +--------------COMP:V-N(from)--------------+                                |     
    +---------OBJ:V-N--------+-----------------------------SUBJ:V-N-----------------------------+--------OBJ:V-N--------+                  |                                |     
    |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                       |           +MOD_ATT:N-N+                  |                +-MOD_ATT:N-ADJ-+     
    |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
OBJ:V-N (__SP__,decrease)
MOD_ATT:N-ADJ (decrease,__NODE__)
MOD_ATT:N-N (decrease,protein)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
COMP:V-N(from) (contain,__NODE__)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A11">Analyse 11

                                                                                                +-------------------------------COMP:V-N(from)------------------------------+     
                                                                                                +--------------COMP:V-N(from)--------------+                                |     
    +---------OBJ:V-N--------+-----------------------------SUBJ:V-N-----------------------------+--------OBJ:V-N--------+                  |                                |     
    |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                       |           +MOD_ATT:N-N+                  |                +-MOD_ATT:N-ADJ-+     
    |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
OBJ:V-N (__SP__,decrease)
MOD_ATT:N-ADJ (decrease,__NODE__)
MOD_ATT:N-N (decrease,protein)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
COMP:V-N(from) (contain,__NODE__)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A12">Analyse 12

    +---------OBJ:V-N--------+-----------------------------SUBJ:V-N-----------------------------+--------OBJ:V-N--------+                                                         
    |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                       |           +MOD_ATT:N-N+                                   +-MOD_ATT:N-ADJ-+     
    |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
OBJ:V-N (__SP__,decrease)
MOD_ATT:N-ADJ (decrease,__NODE__)
MOD_ATT:N-N (decrease,protein)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A13">Analyse 13

    +---------OBJ:V-N--------+-----------------------------SUBJ:V-N-----------------------------+--------OBJ:V-N--------+                                                         
    |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                       |           +MOD_ATT:N-N+                                   +-MOD_ATT:N-ADJ-+     
    |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
OBJ:V-N (__SP__,decrease)
MOD_ATT:N-ADJ (decrease,__NODE__)
MOD_ATT:N-N (decrease,protein)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A14">Analyse 14

                             +---------------------------------------------------------------SUBJ:V-N---------------------------------------------------------------+             
                             |                                                                  +-----------------------COMP:V-N(from)----------------------+       |             
                             |                                                                  +--------------COMP:V-N(from)--------------+                |       |             
    +------MOD_ATT:N-ADJ-----+-----------------------------SUBJ:V-N-----------------------------+--------OBJ:V-N--------+                  |                |       |             
    |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                       |           +MOD_ATT:N-N+                  |                |       |             
    |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +OBJ:V-N+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (decrease,__SP__)
MOD_ATT:N-ADJ (decrease,__NODE__)
MOD_ATT:N-N (decrease,protein)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
COMP:V-N(from) (contain,__NODE__)
COMP:V-N(from) (contain,__SP__)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

name="reponse" value="A15">Analyse 15

                             +---------------------------------------------------------------SUBJ:V-N---------------------------------------------------------------+             
                             |                                                                  +-----------------------COMP:V-N(from)----------------------+       |             
                             |                                                                  +--------------COMP:V-N(from)--------------+                |       |             
    +------MOD_ATT:N-ADJ-----+-----------------------------SUBJ:V-N-----------------------------+--------OBJ:V-N--------+                  |                |       |             
    |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                       |           +MOD_ATT:N-N+                  |                |       |             
    |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +OBJ:V-N+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (decrease,__SP__)
MOD_ATT:N-ADJ (decrease,__NODE__)
MOD_ATT:N-N (decrease,protein)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
COMP:V-N(from) (contain,__NODE__)
COMP:V-N(from) (contain,__SP__)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

name="reponse" value="A16">Analyse 16

                             +-----------------------------------------------------------SUBJ:V-N-----------------------------------------------------------+                     
                             +---------------------------------------------------SUBJ:V-N--------------------------------------------------+                |                     
                             |                                                                  +----------COMP:V-N(from)----------+       |                |                     
    +------MOD_ATT:N-ADJ-----+-----------------------------SUBJ:V-N-----------------------------+--------OBJ:V-N--------+          |       |                |                     
    |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                       |           +MOD_ATT:N-N+          |       |                +----OBJ:V-N----+     
    |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          |       |                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (decrease,__SP__)
MOD_ATT:N-ADJ (decrease,__NODE__)
MOD_ATT:N-N (decrease,protein)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
COMP:V-N(from) (contain,__SP__)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
SUBJ:V-N (__NODE__,decrease)
SUBJ:V-N (__SP__,decrease)
OBJ:V-N (__SP__,protein)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A17">Analyse 17

                             +-----------------------------------------------------------SUBJ:V-N-----------------------------------------------------------+                     
                             +---------------------------------------------------SUBJ:V-N--------------------------------------------------+                |                     
                             |                                                                  +----------COMP:V-N(from)----------+       |                |                     
    +------MOD_ATT:N-ADJ-----+-----------------------------SUBJ:V-N-----------------------------+--------OBJ:V-N--------+          |       |                |                     
    |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                       |           +MOD_ATT:N-N+          |       |                +----OBJ:V-N----+     
    |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          |       |                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (decrease,__SP__)
MOD_ATT:N-ADJ (decrease,__NODE__)
MOD_ATT:N-N (decrease,protein)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
COMP:V-N(from) (contain,__SP__)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
SUBJ:V-N (__NODE__,decrease)
SUBJ:V-N (__SP__,decrease)
OBJ:V-N (__SP__,protein)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A18">Analyse 18

                                                                                                                        +-------------------COMP:N-N(from)------------------+     
                                                                                                                        |          +--------------MOD_ATT:N-ADJ-------------+     
    +---------OBJ:V-N--------+-----------------------------SUBJ:V-N-----------------------------+--------OBJ:V-N--------+          |       +----------MOD_ATT:N-ADJ---------+     
    |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                       |           +MOD_ATT:N-N+          |       |                +-MOD_ATT:N-ADJ-+     
    |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          |       |                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
OBJ:V-N (__SP__,decrease)
MOD_ATT:N-ADJ (decrease,__NODE__)
MOD_ATT:N-N (decrease,protein)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
COMP:N-N(from) (site,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A19">Analyse 19

                                                                                                                        +-------------------COMP:N-N(from)------------------+     
                                                                                                                        |          +--------------MOD_ATT:N-ADJ-------------+     
    +---------OBJ:V-N--------+-----------------------------SUBJ:V-N-----------------------------+--------OBJ:V-N--------+          |       +----------MOD_ATT:N-ADJ---------+     
    |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                       |           +MOD_ATT:N-N+          |       |                +-MOD_ATT:N-ADJ-+     
    |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          |       |                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
OBJ:V-N (__SP__,decrease)
MOD_ATT:N-ADJ (decrease,__NODE__)
MOD_ATT:N-N (decrease,protein)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
COMP:N-N(from) (site,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A20">Analyse 20

                             +-----------------------------------------------------------SUBJ:V-N-----------------------------------------------------------+                     
                             +---------------------------------------------------SUBJ:V-N--------------------------------------------------+                |                     
    +------MOD_ATT:N-ADJ-----+-----------------------------SUBJ:V-N-----------------------------+--------OBJ:V-N--------+                  +-------------OBJ:V-N------------+     
    |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                       |           +MOD_ATT:N-N+                  |                +----OBJ:V-N----+     
    |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+COMP:N-N(f+       |                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (decrease,__SP__)
MOD_ATT:N-ADJ (decrease,__NODE__)
MOD_ATT:N-N (decrease,protein)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
COMP:N-N(from) (site,__SP__)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)
SUBJ:V-N (__SP__,decrease)
OBJ:V-N (__SP__,protein)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A21">Analyse 21

                             +-----------------------------------------------------------SUBJ:V-N-----------------------------------------------------------+                     
                             +---------------------------------------------------SUBJ:V-N--------------------------------------------------+                |                     
    +------MOD_ATT:N-ADJ-----+-----------------------------SUBJ:V-N-----------------------------+--------OBJ:V-N--------+                  +-------------OBJ:V-N------------+     
    |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                       |           +MOD_ATT:N-N+                  |                +----OBJ:V-N----+     
    |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+COMP:N-N(f+       |                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (decrease,__SP__)
MOD_ATT:N-ADJ (decrease,__NODE__)
MOD_ATT:N-N (decrease,protein)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
COMP:N-N(from) (site,__SP__)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)
SUBJ:V-N (__SP__,decrease)
OBJ:V-N (__SP__,protein)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A22">Analyse 22

                             +---------------------------------------------------------------SUBJ:V-N---------------------------------------------------------------+             
                             |                                                                                          +-----------COMP:N-N(from)----------+       |             
    +------MOD_ATT:N-ADJ-----+-----------------------------SUBJ:V-N-----------------------------+--------OBJ:V-N--------+          +------MOD_ATT:N-ADJ-----+       |             
    |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                       |           +MOD_ATT:N-N+--COMP:N-N(from)--+                |       |             
    |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +OBJ:V-N+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (decrease,__SP__)
MOD_ATT:N-ADJ (decrease,__NODE__)
MOD_ATT:N-N (decrease,protein)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
COMP:N-N(from) (site,__NODE__)
COMP:N-N(from) (site,__SP__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (__SP__,__SP__)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

name="reponse" value="A23">Analyse 23

                             +---------------------------------------------------------------SUBJ:V-N---------------------------------------------------------------+             
                             |                                                                                          +-----------COMP:N-N(from)----------+       |             
    +------MOD_ATT:N-ADJ-----+-----------------------------SUBJ:V-N-----------------------------+--------OBJ:V-N--------+          +------MOD_ATT:N-ADJ-----+       |             
    |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                       |           +MOD_ATT:N-N+--COMP:N-N(from)--+                |       |             
    |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +OBJ:V-N+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (decrease,__SP__)
MOD_ATT:N-ADJ (decrease,__NODE__)
MOD_ATT:N-N (decrease,protein)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
COMP:N-N(from) (site,__NODE__)
COMP:N-N(from) (site,__SP__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (__SP__,__SP__)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

name="reponse" value="A24">Analyse 24

                             +---------------------------------------------------------------SUBJ:V-N---------------------------------------------------------------+             
                             |                                                                                          +-----------COMP:N-N(from)----------+       |             
    +------MOD_ATT:N-ADJ-----+-----------------------------SUBJ:V-N-----------------------------+--------OBJ:V-N--------+          +------MOD_ATT:N-ADJ-----+       |             
    |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                       |           +MOD_ATT:N-N+          |       +--MOD_ATT:N-ADJ-+       |             
    |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          |       |      +MOD_ATT:N+       +OBJ:V-N+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |      |         |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (decrease,__SP__)
MOD_ATT:N-ADJ (decrease,__NODE__)
MOD_ATT:N-N (decrease,protein)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
COMP:N-N(from) (site,__SP__)
MOD_ATT:N-ADJ (__SP__,__SP__)
MOD_ATT:N-ADJ (__SP__,__NODE__)
MOD_ATT:N-N (__SP__,gene)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

name="reponse" value="A25">Analyse 25

                             +---------------------------------------------------------------SUBJ:V-N---------------------------------------------------------------+             
                             |                                                                                          +-----------COMP:N-N(from)----------+       |             
    +------MOD_ATT:N-ADJ-----+-----------------------------SUBJ:V-N-----------------------------+--------OBJ:V-N--------+          +------MOD_ATT:N-ADJ-----+       |             
    |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                       |           +MOD_ATT:N-N+          |       +--MOD_ATT:N-ADJ-+       |             
    |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          |       |      +MOD_ATT:N+       +OBJ:V-N+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |      |         |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (decrease,__SP__)
MOD_ATT:N-ADJ (decrease,__NODE__)
MOD_ATT:N-N (decrease,protein)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
COMP:N-N(from) (site,__SP__)
MOD_ATT:N-ADJ (__SP__,__SP__)
MOD_ATT:N-ADJ (__SP__,__NODE__)
MOD_ATT:N-N (__SP__,gene)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

name="reponse" value="A26">Analyse 26

    +---------OBJ:V-N--------+-----------------------------SUBJ:V-N-----------------------------+--------OBJ:V-N--------+-------------------COMP:N-N(from)------------------+     
    |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                       |           +MOD_ATT:N-N+--COMP:N-N(from)--+                +-MOD_ATT:N-ADJ-+     
    |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
OBJ:V-N (__SP__,decrease)
MOD_ATT:N-ADJ (decrease,__NODE__)
MOD_ATT:N-N (decrease,protein)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
COMP:N-N(from) (site,__NODE__)
COMP:N-N(from) (site,protein)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A27">Analyse 27

    +---------OBJ:V-N--------+-----------------------------SUBJ:V-N-----------------------------+--------OBJ:V-N--------+-------------------COMP:N-N(from)------------------+     
    |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                       |           +MOD_ATT:N-N+--COMP:N-N(from)--+                +-MOD_ATT:N-ADJ-+     
    |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
OBJ:V-N (__SP__,decrease)
MOD_ATT:N-ADJ (decrease,__NODE__)
MOD_ATT:N-N (decrease,protein)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
COMP:N-N(from) (site,__NODE__)
COMP:N-N(from) (site,protein)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A28">Analyse 28

                             +---------------------------------------------------------------SUBJ:V-N---------------------------------------------------------------+             
    +------MOD_ATT:N-ADJ-----+-----------------------------SUBJ:V-N-----------------------------+--------OBJ:V-N--------+-----------COMP:N-N(from)----------+       |             
    |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                       |           +MOD_ATT:N-N+--COMP:N-N(from)--+                |       |             
    |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +OBJ:V-N+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (decrease,__SP__)
MOD_ATT:N-ADJ (decrease,__NODE__)
MOD_ATT:N-N (decrease,protein)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
COMP:N-N(from) (site,__NODE__)
COMP:N-N(from) (site,__SP__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

name="reponse" value="A29">Analyse 29

                             +---------------------------------------------------------------SUBJ:V-N---------------------------------------------------------------+             
    +------MOD_ATT:N-ADJ-----+-----------------------------SUBJ:V-N-----------------------------+--------OBJ:V-N--------+-----------COMP:N-N(from)----------+       |             
    |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                       |           +MOD_ATT:N-N+--COMP:N-N(from)--+                |       |             
    |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +OBJ:V-N+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (decrease,__SP__)
MOD_ATT:N-ADJ (decrease,__NODE__)
MOD_ATT:N-N (decrease,protein)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
COMP:N-N(from) (site,__NODE__)
COMP:N-N(from) (site,__SP__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

name="reponse" value="A30">Analyse 30

                             +-----------------------------------------------------------SUBJ:V-N-----------------------------------------------------------+                     
                             +---------------------------------------------------SUBJ:V-N--------------------------------------------------+                |                     
    +------MOD_ATT:N-ADJ-----+-----------------------------SUBJ:V-N-----------------------------+--------OBJ:V-N--------+                  |                |                     
    |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                       |           +MOD_ATT:N-N+                  |                +----OBJ:V-N----+     
    |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+COMP:N-N(f+       |                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (decrease,__SP__)
MOD_ATT:N-ADJ (decrease,__NODE__)
MOD_ATT:N-N (decrease,protein)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
COMP:N-N(from) (site,__SP__)
SUBJ:V-N (__NODE__,decrease)
SUBJ:V-N (__SP__,decrease)
OBJ:V-N (__SP__,protein)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A31">Analyse 31

                             +-----------------------------------------------------------SUBJ:V-N-----------------------------------------------------------+                     
                             +---------------------------------------------------SUBJ:V-N--------------------------------------------------+                |                     
    +------MOD_ATT:N-ADJ-----+-----------------------------SUBJ:V-N-----------------------------+--------OBJ:V-N--------+                  |                |                     
    |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                       |           +MOD_ATT:N-N+                  |                +----OBJ:V-N----+     
    |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+COMP:N-N(f+       |                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (decrease,__SP__)
MOD_ATT:N-ADJ (decrease,__NODE__)
MOD_ATT:N-N (decrease,protein)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
COMP:N-N(from) (site,__SP__)
SUBJ:V-N (__NODE__,decrease)
SUBJ:V-N (__SP__,decrease)
OBJ:V-N (__SP__,protein)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A32">Analyse 32

                                                                                                +----------------------------------OBJ:V-N----------------------------------+     
    +---------OBJ:V-N--------+-----------------------------SUBJ:V-N-----------------------------+--------OBJ:V-N--------+                                                   |     
    |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                       |           +MOD_ATT:N-N+--COMP:N-N(from)--+                +-MOD_ATT:N-ADJ-+     
    |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
OBJ:V-N (__SP__,decrease)
MOD_ATT:N-ADJ (decrease,__NODE__)
MOD_ATT:N-N (decrease,protein)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
COMP:N-N(from) (site,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A33">Analyse 33

                                                                                                +----------------------------------OBJ:V-N----------------------------------+     
    +---------OBJ:V-N--------+-----------------------------SUBJ:V-N-----------------------------+--------OBJ:V-N--------+                                                   |     
    |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                       |           +MOD_ATT:N-N+--COMP:N-N(from)--+                +-MOD_ATT:N-ADJ-+     
    |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
OBJ:V-N (__SP__,decrease)
MOD_ATT:N-ADJ (decrease,__NODE__)
MOD_ATT:N-N (decrease,protein)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
COMP:N-N(from) (site,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A34">Analyse 34

                             +---------------------------------------------------------------SUBJ:V-N---------------------------------------------------------------+             
                             |                                                                  +--------------------------OBJ:V-N--------------------------+       |             
    +------MOD_ATT:N-ADJ-----+-----------------------------SUBJ:V-N-----------------------------+--------OBJ:V-N--------+                                   |       |             
    |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                       |           +MOD_ATT:N-N+--COMP:N-N(from)--+                |       |             
    |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +OBJ:V-N+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (decrease,__SP__)
MOD_ATT:N-ADJ (decrease,__NODE__)
MOD_ATT:N-N (decrease,protein)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
COMP:N-N(from) (site,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

name="reponse" value="A35">Analyse 35

                             +---------------------------------------------------------------SUBJ:V-N---------------------------------------------------------------+             
                             |                                                                  +--------------------------OBJ:V-N--------------------------+       |             
    +------MOD_ATT:N-ADJ-----+-----------------------------SUBJ:V-N-----------------------------+--------OBJ:V-N--------+                                   |       |             
    |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                       |           +MOD_ATT:N-N+--COMP:N-N(from)--+                |       |             
    |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +OBJ:V-N+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (decrease,__SP__)
MOD_ATT:N-ADJ (decrease,__NODE__)
MOD_ATT:N-N (decrease,protein)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
COMP:N-N(from) (site,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

name="reponse" value="A36">Analyse 36

                                                                                                +-------------------------------COMP:V-N(from)------------------------------+     
                                                                                                |                                  +--------------MOD_ATT:N-ADJ-------------+     
                                      +-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+          |       +----------MOD_ATT:N-ADJ---------+     
    +-MOD_ATT:N-ADJ-+                 +---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+          |       |                +-MOD_ATT:N-ADJ-+     
    |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          |       |                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (decrease,protein)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A37">Analyse 37

                                                                                                +-------------------------------COMP:V-N(from)------------------------------+     
                                                                                                |                                  +--------------MOD_ATT:N-ADJ-------------+     
                                      +-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+          |       +----------MOD_ATT:N-ADJ---------+     
    +-MOD_ATT:N-ADJ-+                 +---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+          |       |                +-MOD_ATT:N-ADJ-+     
    |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          |       |                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (decrease,protein)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A38">Analyse 38

                             +----------------------------------------------------------------COMP:V-N(from)----------------------------------------------------------------+     
                             |                                                                                                     +--------------MOD_ATT:N-ADJ-------------+     
                             |        +-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+          |       +----------MOD_ATT:N-ADJ---------+     
    +-MOD_ATT:N-ADJ-+        |        +---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+          |       |                +-MOD_ATT:N-ADJ-+     
    |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          |       |                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (decrease,protein)
OBJ:V-N (decrease,bind)
COMP:V-N(from) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A39">Analyse 39

                             +----------------------------------------------------------------COMP:V-N(from)----------------------------------------------------------------+     
                             |                                                                                                     +--------------MOD_ATT:N-ADJ-------------+     
                             |        +-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+          |       +----------MOD_ATT:N-ADJ---------+     
    +-MOD_ATT:N-ADJ-+        |        +---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+          |       |                +-MOD_ATT:N-ADJ-+     
    |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          |       |                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (decrease,protein)
OBJ:V-N (decrease,bind)
COMP:V-N(from) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A40">Analyse 40

                             +---------------------------------------------------SUBJ:V-N--------------------------------------------------+                                      
                             |                                                                  +----------COMP:V-N(from)----------+       +-------------OBJ:V-N------------+     
    +------MOD_ATT:N-ADJ-----+-----------------------------SUBJ:V-N-----------------------------+--------OBJ:V-N--------+          |       |      +-------MOD_ATT:N-N-------+     
    |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                       |           +MOD_ATT:N-N+          |       |      |         +-MOD_ATT:N-ADJ-+     
    |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          |       |      |         |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |      |         |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (decrease,__SP__)
MOD_ATT:N-ADJ (decrease,__NODE__)
MOD_ATT:N-N (decrease,protein)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
COMP:V-N(from) (contain,__SP__)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A41">Analyse 41

                             +---------------------------------------------------SUBJ:V-N--------------------------------------------------+                                      
                             |                                                                  +----------COMP:V-N(from)----------+       +-------------OBJ:V-N------------+     
    +------MOD_ATT:N-ADJ-----+-----------------------------SUBJ:V-N-----------------------------+--------OBJ:V-N--------+          |       |      +-------MOD_ATT:N-N-------+     
    |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                       |           +MOD_ATT:N-N+          |       |      |         +-MOD_ATT:N-ADJ-+     
    |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          |       |      |         |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |      |         |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (decrease,__SP__)
MOD_ATT:N-ADJ (decrease,__NODE__)
MOD_ATT:N-N (decrease,protein)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
COMP:V-N(from) (contain,__SP__)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A42">Analyse 42

                                                                                                +-------------------------------COMP:V-N(from)------------------------------+     
                                                                                                +--------------COMP:V-N(from)--------------+                                |     
                                      +-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+                  |                                |     
    +-MOD_ATT:N-ADJ-+                 +---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+                  |                +-MOD_ATT:N-ADJ-+     
    |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (decrease,protein)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
COMP:V-N(from) (contain,__NODE__)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A43">Analyse 43

                                                                                                +-------------------------------COMP:V-N(from)------------------------------+     
                                                                                                +--------------COMP:V-N(from)--------------+                                |     
                                      +-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+                  |                                |     
    +-MOD_ATT:N-ADJ-+                 +---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+                  |                +-MOD_ATT:N-ADJ-+     
    |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (decrease,protein)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
COMP:V-N(from) (contain,__NODE__)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A44">Analyse 44

                             +----------------------------------------------------------------COMP:V-N(from)----------------------------------------------------------------+     
                             +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                                |     
                             |        +-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+                  |                                |     
    +-MOD_ATT:N-ADJ-+        |        +---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+                  |                +-MOD_ATT:N-ADJ-+     
    |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (decrease,protein)
OBJ:V-N (decrease,bind)
COMP:V-N(from) (decrease,__NODE__)
COMP:V-N(from) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A45">Analyse 45

                             +----------------------------------------------------------------COMP:V-N(from)----------------------------------------------------------------+     
                             +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                                |     
                             |        +-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+                  |                                |     
    +-MOD_ATT:N-ADJ-+        |        +---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+                  |                +-MOD_ATT:N-ADJ-+     
    |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (decrease,protein)
OBJ:V-N (decrease,bind)
COMP:V-N(from) (decrease,__NODE__)
COMP:V-N(from) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A46">Analyse 46

                                                                                                +----------------------------------OBJ:V-N----------------------------------+     
                                                                                                +---------------------OBJ:V-N---------------------+                         |     
                                                                                                |           +-------------MOD_ATT:N-N-------------+                         |     
                                                                                                |           |    +-----------MOD_ATT:N-N----------+                         |     
    +---------OBJ:V-N--------+-----------------------------SUBJ:V-N-----------------------------+           |    |      +-------MOD_ATT:N-N-------+                         |     
    |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                       |           |    |      |          +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+     
    |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    |      |          |       +MOD_AT+         |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |      |         |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
OBJ:V-N (__SP__,decrease)
MOD_ATT:N-ADJ (decrease,__NODE__)
MOD_ATT:N-N (decrease,protein)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,gene)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (gene,1)
MOD_ATT:N-N (gene,binding)
MOD_ATT:N-N (gene,site)
MOD_ATT:N-ADJ (gene,__SP__)
MOD_ATT:N-ADJ (gene,__NODE__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A47">Analyse 47

                             +---------------------------------------------------------------SUBJ:V-N---------------------------------------------------------------+             
                             |                                                                  +--------------------------OBJ:V-N--------------------------+       |             
                             |                                                                  +---------------------OBJ:V-N---------------------+         |       |             
                             |                                                                  |           +-------------MOD_ATT:N-N-------------+         |       |             
                             |                                                                  |           |    +-----------MOD_ATT:N-N----------+         |       |             
    +------MOD_ATT:N-ADJ-----+-----------------------------SUBJ:V-N-----------------------------+           |    |      +-------MOD_ATT:N-N-------+         |       |             
    |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                       |           |    |      |          +-MOD_ATT:N-ADJ+         |       |             
    |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    |      |          |       +MOD_AT+         |       +OBJ:V-N+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |      |         |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (decrease,__SP__)
MOD_ATT:N-ADJ (decrease,__NODE__)
MOD_ATT:N-N (decrease,protein)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,gene)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-N (gene,1)
MOD_ATT:N-N (gene,binding)
MOD_ATT:N-N (gene,site)
MOD_ATT:N-ADJ (gene,__SP__)
MOD_ATT:N-ADJ (gene,__NODE__)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

name="reponse" value="A48">Analyse 48

                                                                                                                        +-------------------COMP:N-N(from)------------------+     
                                                                                                                        |          +--------------MOD_ATT:N-ADJ-------------+     
                                      +-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+          |       +----------MOD_ATT:N-ADJ---------+     
    +-MOD_ATT:N-ADJ-+                 +---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+          |       |                +-MOD_ATT:N-ADJ-+     
    |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          |       |                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (decrease,protein)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
COMP:N-N(from) (site,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A49">Analyse 49

                                                                                                                        +-------------------COMP:N-N(from)------------------+     
                                                                                                                        |          +--------------MOD_ATT:N-ADJ-------------+     
                                      +-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+          |       +----------MOD_ATT:N-ADJ---------+     
    +-MOD_ATT:N-ADJ-+                 +---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+          |       |                +-MOD_ATT:N-ADJ-+     
    |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          |       |                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (decrease,protein)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
COMP:N-N(from) (site,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A50">Analyse 50

                             +---------------------------------------------------SUBJ:V-N--------------------------------------------------+-------------OBJ:V-N------------+     
    +------MOD_ATT:N-ADJ-----+-----------------------------SUBJ:V-N-----------------------------+--------OBJ:V-N--------+                  |      +-------MOD_ATT:N-N-------+     
    |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                       |           +MOD_ATT:N-N+                  |      |         +-MOD_ATT:N-ADJ-+     
    |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+COMP:N-N(f+       |      |         |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |      |         |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (decrease,__SP__)
MOD_ATT:N-ADJ (decrease,__NODE__)
MOD_ATT:N-N (decrease,protein)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
COMP:N-N(from) (site,__SP__)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A51">Analyse 51

                             +---------------------------------------------------SUBJ:V-N--------------------------------------------------+-------------OBJ:V-N------------+     
    +------MOD_ATT:N-ADJ-----+-----------------------------SUBJ:V-N-----------------------------+--------OBJ:V-N--------+                  |      +-------MOD_ATT:N-N-------+     
    |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                       |           +MOD_ATT:N-N+                  |      |         +-MOD_ATT:N-ADJ-+     
    |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+COMP:N-N(f+       |      |         |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |      |         |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (decrease,__SP__)
MOD_ATT:N-ADJ (decrease,__NODE__)
MOD_ATT:N-N (decrease,protein)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
COMP:N-N(from) (site,__SP__)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A52">Analyse 52

                                      +-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+-------------------COMP:N-N(from)------------------+     
    +-MOD_ATT:N-ADJ-+                 +---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+--COMP:N-N(from)--+                +-MOD_ATT:N-ADJ-+     
    |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (decrease,protein)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
COMP:N-N(from) (site,__NODE__)
COMP:N-N(from) (site,protein)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A53">Analyse 53

                                      +-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+-------------------COMP:N-N(from)------------------+     
    +-MOD_ATT:N-ADJ-+                 +---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+--COMP:N-N(from)--+                +-MOD_ATT:N-ADJ-+     
    |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (decrease,protein)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
COMP:N-N(from) (site,__NODE__)
COMP:N-N(from) (site,protein)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A54">Analyse 54

                                                                                                +----------------------------------OBJ:V-N----------------------------------+     
                                      +-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+                                                   |     
    +-MOD_ATT:N-ADJ-+                 +---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+--COMP:N-N(from)--+                +-MOD_ATT:N-ADJ-+     
    |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (decrease,protein)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
COMP:N-N(from) (site,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A55">Analyse 55

                                                                                                +----------------------------------OBJ:V-N----------------------------------+     
                                      +-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+                                                   |     
    +-MOD_ATT:N-ADJ-+                 +---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+--COMP:N-N(from)--+                +-MOD_ATT:N-ADJ-+     
    |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (decrease,protein)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
COMP:N-N(from) (site,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A56">Analyse 56

                                                                                                +-------------------------------COMP:V-N(from)------------------------------+     
                                                                                                |                                  +--------------MOD_ATT:N-ADJ-------------+     
                                      +-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+          |       +----------MOD_ATT:N-ADJ---------+     
    +-MOD_ATT:N-ADJ-+                 +---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+          |       |                +-MOD_ATT:N-ADJ-+     
    |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          |       |                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (decrease,protein)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A57">Analyse 57

                                                                                                +-------------------------------COMP:V-N(from)------------------------------+     
                                                                                                |                                  +--------------MOD_ATT:N-ADJ-------------+     
                                      +-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+          |       +----------MOD_ATT:N-ADJ---------+     
    +-MOD_ATT:N-ADJ-+                 +---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+          |       |                +-MOD_ATT:N-ADJ-+     
    |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          |       |                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (decrease,protein)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A58">Analyse 58

                                                                                                +-------------------------------COMP:V-N(from)------------------------------+     
    +-------------OBJ:V-N-------------+                                                         |                                  +--------------MOD_ATT:N-ADJ-------------+     
    |       +------MOD_ATT:N-ADJ------+-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+          |       +----------MOD_ATT:N-ADJ---------+     
    |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+          |       |                +-MOD_ATT:N-ADJ-+     
    |       |       |        +MOD_ATT:+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          |       |                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
OBJ:V-N (__SP__,bind)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A59">Analyse 59

                                                                                                +-------------------------------COMP:V-N(from)------------------------------+     
    +-------------OBJ:V-N-------------+                                                         |                                  +--------------MOD_ATT:N-ADJ-------------+     
    |       +------MOD_ATT:N-ADJ------+-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+          |       +----------MOD_ATT:N-ADJ---------+     
    |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+          |       |                +-MOD_ATT:N-ADJ-+     
    |       |       |        +MOD_ATT:+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          |       |                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
OBJ:V-N (__SP__,bind)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A60">Analyse 60

                             +----------------------------------------------------------------COMP:V-N(from)----------------------------------------------------------------+     
                             |                                                                                                     +--------------MOD_ATT:N-ADJ-------------+     
                             |        +-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+          |       +----------MOD_ATT:N-ADJ---------+     
    +-MOD_ATT:N-ADJ-+        |        +---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+          |       |                +-MOD_ATT:N-ADJ-+     
    |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          |       |                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (decrease,protein)
OBJ:V-N (decrease,bind)
COMP:V-N(from) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A61">Analyse 61

                             +----------------------------------------------------------------COMP:V-N(from)----------------------------------------------------------------+     
                             |                                                                                                     +--------------MOD_ATT:N-ADJ-------------+     
                             |        +-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+          |       +----------MOD_ATT:N-ADJ---------+     
    +-MOD_ATT:N-ADJ-+        |        +---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+          |       |                +-MOD_ATT:N-ADJ-+     
    |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          |       |                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (decrease,protein)
OBJ:V-N (decrease,bind)
COMP:V-N(from) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A62">Analyse 62

    +-------------OBJ:V-N-------------+                                                                                            +--------------MOD_ATT:N-ADJ-------------+     
    |       +------MOD_ATT:N-ADJ------+-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+          |       +----------MOD_ATT:N-ADJ---------+     
    |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+          |       |                +-MOD_ATT:N-ADJ-+     
    |       |       |        +MOD_ATT:+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          |       |                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
OBJ:V-N (__SP__,bind)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A63">Analyse 63

    +-------------OBJ:V-N-------------+                                                                                            +--------------MOD_ATT:N-ADJ-------------+     
    |       +------MOD_ATT:N-ADJ------+-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+          |       +----------MOD_ATT:N-ADJ---------+     
    |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+          |       |                +-MOD_ATT:N-ADJ-+     
    |       |       |        +MOD_ATT:+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          |       |                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
OBJ:V-N (__SP__,bind)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A64">Analyse 64

                                                                                                +-------------------------------COMP:V-N(from)------------------------------+     
                                                                                                +--------------COMP:V-N(from)--------------+                                |     
                                      +-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+                  |                                |     
    +-MOD_ATT:N-ADJ-+                 +---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+                  |                +-MOD_ATT:N-ADJ-+     
    |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (decrease,protein)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
COMP:V-N(from) (contain,__NODE__)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A65">Analyse 65

                                                                                                +-------------------------------COMP:V-N(from)------------------------------+     
                                                                                                +--------------COMP:V-N(from)--------------+                                |     
                                      +-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+                  |                                |     
    +-MOD_ATT:N-ADJ-+                 +---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+                  |                +-MOD_ATT:N-ADJ-+     
    |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (decrease,protein)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
COMP:V-N(from) (contain,__NODE__)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A66">Analyse 66

                                                                                                +-------------------------------COMP:V-N(from)------------------------------+     
    +-------------OBJ:V-N-------------+                                                         +--------------COMP:V-N(from)--------------+                                |     
    |       +------MOD_ATT:N-ADJ------+-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+                  |                                |     
    |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+                  |                +-MOD_ATT:N-ADJ-+     
    |       |       |        +MOD_ATT:+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
OBJ:V-N (__SP__,bind)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
COMP:V-N(from) (contain,__NODE__)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A67">Analyse 67

                                                                                                +-------------------------------COMP:V-N(from)------------------------------+     
    +-------------OBJ:V-N-------------+                                                         +--------------COMP:V-N(from)--------------+                                |     
    |       +------MOD_ATT:N-ADJ------+-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+                  |                                |     
    |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+                  |                +-MOD_ATT:N-ADJ-+     
    |       |       |        +MOD_ATT:+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
OBJ:V-N (__SP__,bind)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
COMP:V-N(from) (contain,__NODE__)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A68">Analyse 68

                             +----------------------------------------------------------------COMP:V-N(from)----------------------------------------------------------------+     
                             +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                                |     
                             |        +-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+                  |                                |     
    +-MOD_ATT:N-ADJ-+        |        +---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+                  |                +-MOD_ATT:N-ADJ-+     
    |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (decrease,protein)
OBJ:V-N (decrease,bind)
COMP:V-N(from) (decrease,__NODE__)
COMP:V-N(from) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A69">Analyse 69

                             +----------------------------------------------------------------COMP:V-N(from)----------------------------------------------------------------+     
                             +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                                |     
                             |        +-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+                  |                                |     
    +-MOD_ATT:N-ADJ-+        |        +---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+                  |                +-MOD_ATT:N-ADJ-+     
    |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (decrease,protein)
OBJ:V-N (decrease,bind)
COMP:V-N(from) (decrease,__NODE__)
COMP:V-N(from) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A70">Analyse 70

    +-------------OBJ:V-N-------------+                                                                                                                                           
    |       +------MOD_ATT:N-ADJ------+-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+                                                         
    |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+                                   +-MOD_ATT:N-ADJ-+     
    |       |       |        +MOD_ATT:+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
OBJ:V-N (__SP__,bind)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A71">Analyse 71

    +-------------OBJ:V-N-------------+                                                                                                                                           
    |       +------MOD_ATT:N-ADJ------+-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+                                                         
    |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+                                   +-MOD_ATT:N-ADJ-+     
    |       |       |        +MOD_ATT:+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
OBJ:V-N (__SP__,bind)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A72">Analyse 72

                                                                                                +----------------------------------OBJ:V-N----------------------------------+     
                                                                                                +---------------------OBJ:V-N---------------------+                         |     
                                                                                                |           +-------------MOD_ATT:N-N-------------+                         |     
                                                                                                |           |    +-----------MOD_ATT:N-N----------+                         |     
                                      +-------------------------SUBJ:V-N------------------------+           |    |      +-------MOD_ATT:N-N-------+                         |     
    +-MOD_ATT:N-ADJ-+                 +---COMP:N-N(of)--+                                       |           |    |      |          +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+     
    |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    |      |          |       +MOD_AT+         |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |      |         |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (decrease,protein)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,gene)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (gene,1)
MOD_ATT:N-N (gene,binding)
MOD_ATT:N-N (gene,site)
MOD_ATT:N-ADJ (gene,__SP__)
MOD_ATT:N-ADJ (gene,__NODE__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A73">Analyse 73

                                                                                                                        +-------------------COMP:N-N(from)------------------+     
                                                                                                                        |          +--------------MOD_ATT:N-ADJ-------------+     
                                      +-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+          |       +----------MOD_ATT:N-ADJ---------+     
    +-MOD_ATT:N-ADJ-+                 +---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+          |       |                +-MOD_ATT:N-ADJ-+     
    |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          |       |                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (decrease,protein)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
COMP:N-N(from) (site,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A74">Analyse 74

                                                                                                                        +-------------------COMP:N-N(from)------------------+     
                                                                                                                        |          +--------------MOD_ATT:N-ADJ-------------+     
                                      +-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+          |       +----------MOD_ATT:N-ADJ---------+     
    +-MOD_ATT:N-ADJ-+                 +---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+          |       |                +-MOD_ATT:N-ADJ-+     
    |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          |       |                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (decrease,protein)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
COMP:N-N(from) (site,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A75">Analyse 75

                                                                                                                        +-------------------COMP:N-N(from)------------------+     
    +-------------OBJ:V-N-------------+                                                                                 |          +--------------MOD_ATT:N-ADJ-------------+     
    |       +------MOD_ATT:N-ADJ------+-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+          |       +----------MOD_ATT:N-ADJ---------+     
    |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+          |       |                +-MOD_ATT:N-ADJ-+     
    |       |       |        +MOD_ATT:+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          |       |                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
OBJ:V-N (__SP__,bind)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
COMP:N-N(from) (site,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A76">Analyse 76

                                                                                                                        +-------------------COMP:N-N(from)------------------+     
    +-------------OBJ:V-N-------------+                                                                                 |          +--------------MOD_ATT:N-ADJ-------------+     
    |       +------MOD_ATT:N-ADJ------+-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+          |       +----------MOD_ATT:N-ADJ---------+     
    |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+          |       |                +-MOD_ATT:N-ADJ-+     
    |       |       |        +MOD_ATT:+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          |       |                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
OBJ:V-N (__SP__,bind)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
COMP:N-N(from) (site,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A77">Analyse 77

                                      +-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+-------------------COMP:N-N(from)------------------+     
    +-MOD_ATT:N-ADJ-+                 +---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+--COMP:N-N(from)--+                +-MOD_ATT:N-ADJ-+     
    |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (decrease,protein)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
COMP:N-N(from) (site,__NODE__)
COMP:N-N(from) (site,protein)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A78">Analyse 78

                                      +-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+-------------------COMP:N-N(from)------------------+     
    +-MOD_ATT:N-ADJ-+                 +---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+--COMP:N-N(from)--+                +-MOD_ATT:N-ADJ-+     
    |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (decrease,protein)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
COMP:N-N(from) (site,__NODE__)
COMP:N-N(from) (site,protein)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A79">Analyse 79

    +-------------OBJ:V-N-------------+                                                                                                                                           
    |       +------MOD_ATT:N-ADJ------+-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+-------------------COMP:N-N(from)------------------+     
    |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+--COMP:N-N(from)--+                +-MOD_ATT:N-ADJ-+     
    |       |       |        +MOD_ATT:+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
OBJ:V-N (__SP__,bind)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
COMP:N-N(from) (site,__NODE__)
COMP:N-N(from) (site,protein)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A80">Analyse 80

    +-------------OBJ:V-N-------------+                                                                                                                                           
    |       +------MOD_ATT:N-ADJ------+-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+-------------------COMP:N-N(from)------------------+     
    |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+--COMP:N-N(from)--+                +-MOD_ATT:N-ADJ-+     
    |       |       |        +MOD_ATT:+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
OBJ:V-N (__SP__,bind)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
COMP:N-N(from) (site,__NODE__)
COMP:N-N(from) (site,protein)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A81">Analyse 81

                                                                                                +----------------------------------OBJ:V-N----------------------------------+     
                                      +-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+                                                   |     
    +-MOD_ATT:N-ADJ-+                 +---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+--COMP:N-N(from)--+                +-MOD_ATT:N-ADJ-+     
    |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (decrease,protein)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
COMP:N-N(from) (site,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A82">Analyse 82

                                                                                                +----------------------------------OBJ:V-N----------------------------------+     
                                      +-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+                                                   |     
    +-MOD_ATT:N-ADJ-+                 +---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+--COMP:N-N(from)--+                +-MOD_ATT:N-ADJ-+     
    |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (decrease,protein)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
COMP:N-N(from) (site,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A83">Analyse 83

    +-------------OBJ:V-N-------------+                                                         +----------------------------------OBJ:V-N----------------------------------+     
    |       +------MOD_ATT:N-ADJ------+-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+                                                   |     
    |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+--COMP:N-N(from)--+                +-MOD_ATT:N-ADJ-+     
    |       |       |        +MOD_ATT:+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
OBJ:V-N (__SP__,bind)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
COMP:N-N(from) (site,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A84">Analyse 84

    +-------------OBJ:V-N-------------+                                                         +----------------------------------OBJ:V-N----------------------------------+     
    |       +------MOD_ATT:N-ADJ------+-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+                                                   |     
    |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+--COMP:N-N(from)--+                +-MOD_ATT:N-ADJ-+     
    |       |       |        +MOD_ATT:+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
OBJ:V-N (__SP__,bind)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
COMP:N-N(from) (site,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A85">Analyse 85

                                                                                                +-------------------------------COMP:V-N(from)------------------------------+     
    +-------------OBJ:V-N-------------+                                                         |                                  +--------------MOD_ATT:N-ADJ-------------+     
    |       +------MOD_ATT:N-ADJ------+-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+          |       +----------MOD_ATT:N-ADJ---------+     
    |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+          |       |                +-MOD_ATT:N-ADJ-+     
    |       |       |        +MOD_ATT:+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          |       |                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
OBJ:V-N (__SP__,bind)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A86">Analyse 86

                                                                                                +-------------------------------COMP:V-N(from)------------------------------+     
    +-------------OBJ:V-N-------------+                                                         |                                  +--------------MOD_ATT:N-ADJ-------------+     
    |       +------MOD_ATT:N-ADJ------+-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+          |       +----------MOD_ATT:N-ADJ---------+     
    |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+          |       |                +-MOD_ATT:N-ADJ-+     
    |       |       |        +MOD_ATT:+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          |       |                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
OBJ:V-N (__SP__,bind)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A87">Analyse 87

    +-------------OBJ:V-N-------------+                                                                                            +--------------MOD_ATT:N-ADJ-------------+     
    |       +------MOD_ATT:N-ADJ------+-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+          |       +----------MOD_ATT:N-ADJ---------+     
    |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+          |       |                +-MOD_ATT:N-ADJ-+     
    |       |       |        +MOD_ATT:+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          |       |                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
OBJ:V-N (__SP__,bind)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A88">Analyse 88

    +-------------OBJ:V-N-------------+                                                                                            +--------------MOD_ATT:N-ADJ-------------+     
    |       +------MOD_ATT:N-ADJ------+-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+          |       +----------MOD_ATT:N-ADJ---------+     
    |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+          |       |                +-MOD_ATT:N-ADJ-+     
    |       |       |        +MOD_ATT:+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          |       |                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
OBJ:V-N (__SP__,bind)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A89">Analyse 89

                                                                                                +-------------------------------COMP:V-N(from)------------------------------+     
    +-------------OBJ:V-N-------------+                                                         +--------------COMP:V-N(from)--------------+                                |     
    |       +------MOD_ATT:N-ADJ------+-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+                  |                                |     
    |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+                  |                +-MOD_ATT:N-ADJ-+     
    |       |       |        +MOD_ATT:+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
OBJ:V-N (__SP__,bind)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
COMP:V-N(from) (contain,__NODE__)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A90">Analyse 90

                                                                                                +-------------------------------COMP:V-N(from)------------------------------+     
    +-------------OBJ:V-N-------------+                                                         +--------------COMP:V-N(from)--------------+                                |     
    |       +------MOD_ATT:N-ADJ------+-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+                  |                                |     
    |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+                  |                +-MOD_ATT:N-ADJ-+     
    |       |       |        +MOD_ATT:+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
OBJ:V-N (__SP__,bind)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
COMP:V-N(from) (contain,__NODE__)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A91">Analyse 91

    +-------------OBJ:V-N-------------+                                                                                                                                           
    |       +------MOD_ATT:N-ADJ------+-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+                                                         
    |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+                                   +-MOD_ATT:N-ADJ-+     
    |       |       |        +MOD_ATT:+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
OBJ:V-N (__SP__,bind)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A92">Analyse 92

    +-------------OBJ:V-N-------------+                                                                                                                                           
    |       +------MOD_ATT:N-ADJ------+-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+                                                         
    |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+                                   +-MOD_ATT:N-ADJ-+     
    |       |       |        +MOD_ATT:+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
OBJ:V-N (__SP__,bind)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A93">Analyse 93

                                                                                                +----------------------------------OBJ:V-N----------------------------------+     
                                                                                                +---------------------OBJ:V-N---------------------+                         |     
                                                                                                |           +-------------MOD_ATT:N-N-------------+                         |     
                                                                                                |           |    +-----------MOD_ATT:N-N----------+                         |     
                                      +-------------------------SUBJ:V-N------------------------+           |    |      +-------MOD_ATT:N-N-------+                         |     
    +-MOD_ATT:N-ADJ-+                 +---COMP:N-N(of)--+                                       |           |    |      |          +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+     
    |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+-------APPOS------+                    |           |    |      |          |       +MOD_AT+         |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |      |         |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (decrease,protein)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,gene)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (gene,1)
MOD_ATT:N-N (gene,binding)
MOD_ATT:N-N (gene,site)
MOD_ATT:N-ADJ (gene,__SP__)
MOD_ATT:N-ADJ (gene,__NODE__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A94">Analyse 94

                                                                                                +----------------------------------OBJ:V-N----------------------------------+     
                                                                                                +---------------------OBJ:V-N---------------------+                         |     
                                                                                                |           +-------------MOD_ATT:N-N-------------+                         |     
    +-------------OBJ:V-N-------------+                                                         |           |    +-----------MOD_ATT:N-N----------+                         |     
    |       +------MOD_ATT:N-ADJ------+-------------------------SUBJ:V-N------------------------+           |    |      +-------MOD_ATT:N-N-------+                         |     
    |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                       |           |    |      |          +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+     
    |       |       |        +MOD_ATT:+          +MOD_AT+-------APPOS------+                    |           |    |      |          |       +MOD_AT+         |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |      |         |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
OBJ:V-N (__SP__,bind)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,gene)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (gene,1)
MOD_ATT:N-N (gene,binding)
MOD_ATT:N-N (gene,site)
MOD_ATT:N-ADJ (gene,__SP__)
MOD_ATT:N-ADJ (gene,__NODE__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A95">Analyse 95

                                                                                                                        +-------------------COMP:N-N(from)------------------+     
    +-------------OBJ:V-N-------------+                                                                                 |          +--------------MOD_ATT:N-ADJ-------------+     
    |       +------MOD_ATT:N-ADJ------+-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+          |       +----------MOD_ATT:N-ADJ---------+     
    |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+          |       |                +-MOD_ATT:N-ADJ-+     
    |       |       |        +MOD_ATT:+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          |       |                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
OBJ:V-N (__SP__,bind)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
COMP:N-N(from) (site,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A96">Analyse 96

                                                                                                                        +-------------------COMP:N-N(from)------------------+     
    +-------------OBJ:V-N-------------+                                                                                 |          +--------------MOD_ATT:N-ADJ-------------+     
    |       +------MOD_ATT:N-ADJ------+-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+          |       +----------MOD_ATT:N-ADJ---------+     
    |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+          |       |                +-MOD_ATT:N-ADJ-+     
    |       |       |        +MOD_ATT:+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          |       |                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
OBJ:V-N (__SP__,bind)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
COMP:N-N(from) (site,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A97">Analyse 97

    +-------------OBJ:V-N-------------+                                                                                                                                           
    |       +------MOD_ATT:N-ADJ------+-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+-------------------COMP:N-N(from)------------------+     
    |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+--COMP:N-N(from)--+                +-MOD_ATT:N-ADJ-+     
    |       |       |        +MOD_ATT:+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
OBJ:V-N (__SP__,bind)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
COMP:N-N(from) (site,__NODE__)
COMP:N-N(from) (site,protein)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A98">Analyse 98

    +-------------OBJ:V-N-------------+                                                                                                                                           
    |       +------MOD_ATT:N-ADJ------+-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+-------------------COMP:N-N(from)------------------+     
    |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+--COMP:N-N(from)--+                +-MOD_ATT:N-ADJ-+     
    |       |       |        +MOD_ATT:+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
OBJ:V-N (__SP__,bind)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
COMP:N-N(from) (site,__NODE__)
COMP:N-N(from) (site,protein)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A99">Analyse 99

    +-------------OBJ:V-N-------------+                                                         +----------------------------------OBJ:V-N----------------------------------+     
    |       +------MOD_ATT:N-ADJ------+-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+                                                   |     
    |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+--COMP:N-N(from)--+                +-MOD_ATT:N-ADJ-+     
    |       |       |        +MOD_ATT:+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
OBJ:V-N (__SP__,bind)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (site,1)
MOD_ATT:N-ADJ (site,binding)
COMP:N-N(from) (site,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A100">Analyse 100

    +-------------OBJ:V-N-------------+                                                         +----------------------------------OBJ:V-N----------------------------------+     
    |       +------MOD_ATT:N-ADJ------+-------------------------SUBJ:V-N------------------------+--------OBJ:V-N--------+                                                   |     
    |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                       |           +MOD_ATT:N-N+--COMP:N-N(from)--+                +-MOD_ATT:N-ADJ-+     
    |       |       |        +MOD_ATT:+          +MOD_AT+-------APPOS------+                    |           |    +MOD_AT+          +MOD_ATT+                |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |                |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
OBJ:V-N (__SP__,bind)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (site,1)
MOD_ATT:N-N (site,binding)
COMP:N-N(from) (site,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A101">Analyse 101

                                                                                                +----------------------------------OBJ:V-N----------------------------------+     
                                                                                                +---------------------OBJ:V-N---------------------+                         |     
                                                                                                |           +-------------MOD_ATT:N-N-------------+                         |     
    +-------------OBJ:V-N-------------+                                                         |           |    +-----------MOD_ATT:N-N----------+                         |     
    |       +------MOD_ATT:N-ADJ------+-------------------------SUBJ:V-N------------------------+           |    |      +-------MOD_ATT:N-N-------+                         |     
    |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                       |           |    |      |          +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+     
    |       |       |        +MOD_ATT:+          +MOD_AT+-------APPOS------+                    |           |    |      |          |       +MOD_AT+         |       +MOD_ATT+     
    |       |       |        |        |          |      |                  |                    |           |    |      |          |       |      |         |       |       |     
 __SP__ __NODE__ protein decreases binding of a DNA fragment ( CCAGCCATGAATAAATGTATAAGGG ) containing a Pit 1 binding site from __SP__ __NODE__ gene and __SP__ __NODE__ protein .
OBJ:V-N (__SP__,bind)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CCAGCCATGAATAAATGTATAAGGG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,gene)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (gene,1)
MOD_ATT:N-N (gene,binding)
MOD_ATT:N-N (gene,site)
MOD_ATT:N-ADJ (gene,__SP__)
MOD_ATT:N-ADJ (gene,__NODE__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)