vers la météo de la validation par utilisateur

Ingenuity438


precedent - 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 - suivant

Phrase 93 - PMID ?

U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .


Non annotée
Je ne sais pas
Je n'ai pas trouvé d'analyse satisfaisante


Commentaires :

Analyse 0
           +-------------------------------------------------SUBJ:V-N-------------------------------------------------+                                                          
           |                                                             +---------------OBJ:V-N--------------+       |                                                          
           |                                                             +----------OBJ:V-N---------+         |       |                                                          
           |                                                             |           +------MOD_ATT:N-ADJ-----+       |                                                          
           +---------------------------SUBJ:V-N--------------------------+           |       +--MOD_ATT:N-ADJ-+       +--------------------COMP:V-N(by)--------------------+     
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         |       |                                    +-MOD_ATT:N-ADJ-+     
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +OBJ:V-N+--SUBJ:V_PASS-N-+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__SP__,__NODE__)
MOD_ATT:N-ADJ (__SP__,binding)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)
COMP:V-N(by) (__NODE__,protein)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 1
           +--------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------+                     
           |                                                             +-----------------------OBJ:V-N----------------------+                            |                     
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                         |                            |                     
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                            +----OBJ:V-N----+     
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+                +MOD:V_+    |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |      |    |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD:V_PASS-ADV (increase,by)
SUBJ:V-N (__SP__,decrease)
OBJ:V-N (__SP__,protein)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 2
           +--------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------+                                 
           |                                                             +-----------------------OBJ:V-N----------------------+                |                                 
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                         |                +--------COMP:V-N(by)-------+     
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           +-MOD_ATT:N-ADJ-+     
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+                |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (increase,decrease)
COMP:V-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 3
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           |                                                             +-----------------------OBJ:V-N----------------------+                                    |             
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+---------------SUBJ:V_PASS-N--------------+                   |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |                   |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+--SUBJ:V_PASS-N-+COMP:V_PASS+       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V_PASS-N (increase,site)
SUBJ:V_PASS-N (increase,protein)
COMP:V_PASS-N(by) (increase,__SP__)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 4
           +-------------------------------------------------SUBJ:V-N-------------------------------------------------+                                                          
           |                                                             +---------------OBJ:V-N--------------+       |                                                          
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+         |       |                        +-----COMP:V_PASS-N(by)-----+     
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         |       |                        |           +-MOD_ATT:N-ADJ-+     
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +OBJ:V-N+--SUBJ:V_PASS-N-+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)
SUBJ:V_PASS-N (increase,protein)
COMP:V_PASS-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 5
           +--------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------+                                 
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                                          +--------COMP:V-N(by)-------+     
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
SUBJ:V-N (increase,decrease)
SUBJ:V-N (increase,protein)
COMP:V-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 6
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           +--------------------------------------------------------------OBJ:V-N--------------------------------------------------------------+                   |             
           |                                                             +-------------------------------SUBJ:V-N------------------------------+                   |             
           |                                                             +-----------------------OBJ:V-N----------------------+                |                   |             
           |                                                             +----------OBJ:V-N---------+--------------SUBJ:V-N--------------+     |                   |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+          |     |                   |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     +COMP:V-N(by+       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,site)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,decrease)
SUBJ:V-N (increase,contain)
COMP:V-N(by) (increase,__SP__)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 7
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           +--------------------------------------------------------------OBJ:V-N--------------------------------------------------------------+                   |             
           |                                                             +-------------------------------SUBJ:V-N------------------------------+                   |             
           |                                                             +-----------------------OBJ:V-N----------------------+                |                   |             
           |                                                             +----------OBJ:V-N---------+                         |                |                   |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |                   |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+                +COMP:V-N(by+       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,decrease)
SUBJ:V-N (increase,contain)
COMP:V-N(by) (increase,__SP__)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 8
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           +--------------------------------------------------------------OBJ:V-N--------------------------------------------------------------+                   |             
           |                                                             +---------------OBJ:V-N--------------+                                |                   |             
           |                                                             +----------OBJ:V-N---------+         |                                |                   |             
           |                                                             |           +------MOD_ATT:N-ADJ-----+                                |                   |             
           +---------------------------SUBJ:V-N--------------------------+           |       +--MOD_ATT:N-ADJ-+                                |                   |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         |                                |                   |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+----SUBJ:V-N----+COMP:V-N(by+       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__SP__,__NODE__)
MOD_ATT:N-ADJ (__SP__,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,decrease)
SUBJ:V-N (increase,protein)
COMP:V-N(by) (increase,__SP__)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 9
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           |                                                             +-----------------------------------COMP:V-N(by)----------------------------------+       |             
           |                                                             +-------------------OBJ:V-N------------------+                                    |       |             
           |                                                             |                          +------------------OBJ:V-N-----------------+           |       |             
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 +---------OBJ:V-N--------+           |       |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |       +----SUBJ:V-N----+           |       |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +-SUBJ:V-N-+     |           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__NODE__)
COMP:V-N(by) (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,site)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 10
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           |                                                             +---------------OBJ:V-N--------------+                                                    |             
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+------------------OBJ:V-N-----------------+                   |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         +-------------OBJ:V-N------------+                   |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+----SUBJ:V-N----+COMP:V-N(by+       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,site)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
COMP:V-N(by) (increase,__SP__)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 11
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           |                                                             +-----------------------------------COMP:V-N(by)----------------------------------+       |             
           |                                                             +---------------OBJ:V-N--------------+                                            |       |             
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+         +-------------OBJ:V-N------------+           |       |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         |               +----SUBJ:V-N----+           |       |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
COMP:V-N(by) (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 12
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           +--------------------------------------------------------------OBJ:V-N--------------------------------------------------------------+                   |             
           |                                                             +-------------------OBJ:V-N------------------+                        |                   |             
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |                        |                   |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |       +----SUBJ:V-N----+                   |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +-SUBJ:V-N-+     +COMP:V-N(by+       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,decrease)
SUBJ:V-N (increase,protein)
COMP:V-N(by) (increase,__SP__)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 13
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           +--------------------------------------------------------------OBJ:V-N--------------------------------------------------------------+                   |             
           |                                                             +-------------------OBJ:V-N------------------+                        |                   |             
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |                        |                   |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |                        |                   |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +----SUBJ:V-N----+COMP:V-N(by+       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (increase,decrease)
SUBJ:V-N (increase,protein)
COMP:V-N(by) (increase,__SP__)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 14
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           |                                                             +-----------------------------------COMP:V-N(by)----------------------------------+       |             
           |                                                             +---------------OBJ:V-N--------------+                                            |       |             
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+         +-------------OBJ:V-N------------+           |       |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         |               +----SUBJ:V-N----+           |       |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
COMP:V-N(by) (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 15
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           |                                                             +-----------------------------------COMP:V-N(by)----------------------------------+       |             
           |                                                             |                          +------------------OBJ:V-N-----------------+           |       |             
           |                                                             +---------------OBJ:V-N--------------+                                |           |       |             
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+         +-------------OBJ:V-N------------+           |       |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         |               +----SUBJ:V-N----+           |       |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
COMP:V-N(by) (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,site)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 16
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           |                                                             +---------------OBJ:V-N--------------+                                                    |             
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+         +-------------OBJ:V-N------------+                   |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         |               +----SUBJ:V-N----+                   |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     +COMP:V-N(by+       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
COMP:V-N(by) (increase,__SP__)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 17
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           |                                                             +-----------------------------------COMP:V-N(by)----------------------------------+       |             
           |                                                             +---------------OBJ:V-N--------------+                                            |       |             
           |                                                             +----------OBJ:V-N---------+         |                                            |       |             
           |                                                             |           +------MOD_ATT:N-ADJ-----+                                            |       |             
           +---------------------------SUBJ:V-N--------------------------+           |       +--MOD_ATT:N-ADJ-+-------------OBJ:V-N------------+           |       |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         |               +----SUBJ:V-N----+           |       |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
COMP:V-N(by) (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__SP__,__NODE__)
MOD_ATT:N-ADJ (__SP__,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 18
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           |                                                             +---------------OBJ:V-N--------------+                                                    |             
           |                                                             +----------OBJ:V-N---------+         |                                                    |             
           |                                                             |           +------MOD_ATT:N-ADJ-----+                                                    |             
           +---------------------------SUBJ:V-N--------------------------+           |       +--MOD_ATT:N-ADJ-+                                                    |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         +-------------OBJ:V-N------------+                   |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+----SUBJ:V-N----+COMP:V-N(by+       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__SP__,__NODE__)
MOD_ATT:N-ADJ (__SP__,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
COMP:V-N(by) (increase,__SP__)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 19
           +--------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------+                     
           +--------------------------------------------------------------OBJ:V-N--------------------------------------------------------------+           |                     
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+         +------------------SUBJ:V-N------------------+                     
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         +-------------OBJ:V-N------------+           +----OBJ:V-N----+     
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+----SUBJ:V-N----+MOD:V-+    |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |      |    |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,decrease)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
MOD:V-ADV (increase,by)
SUBJ:V-N (__SP__,decrease)
SUBJ:V-N (__SP__,__SP__)
OBJ:V-N (__SP__,protein)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 20
           +--------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------+                                 
           |                                                             +-----------------------OBJ:V-N----------------------+                |                                 
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+--------------SUBJ:V-N--------------+     +--------COMP:V-N(by)-------+     
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+          |     |           +-MOD_ATT:N-ADJ-+     
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,site)
SUBJ:V-N (be,protein)
SUBJ:V-N (increase,decrease)
COMP:V-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 21
           +--------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------+                                 
           |                                                             +-----------------------OBJ:V-N----------------------+                |                                 
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                         |                +----------OBJ:V-N----------+     
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                +----COMP:V-N(by)---+       |     
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+                |           +MOD_ATT+       |     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (increase,decrease)
COMP:V-N(by) (increase,__NODE__)
OBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (__NODE__,__SP__)

Analyse 22
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           +-----------------------------------------------------------SUBJ:V_PASS-N-----------------------------------------------------------+                   |             
           |                                                             +-----------------------OBJ:V-N----------------------+                |                   |             
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                         |                |                   |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |                   |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+                +COMP:V_PASS+       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V_PASS-N (increase,decrease)
COMP:V_PASS-N(by) (increase,__SP__)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 23
           +--------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------+                                 
           |                                                             +-----------------------OBJ:V-N----------------------+                |                                 
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                         |                |                                 
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                +----------OBJ:V-N----------+     
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+                +COMP:V-N(by+       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (increase,decrease)
COMP:V-N(by) (increase,__SP__)
OBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 24
                                                                         +-------------------------------------------COMP:V-N(by)------------------------------------------+     
                                                                         +-----------------------OBJ:V-N----------------------+                                            |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+---------------SUBJ:V_PASS-N--------------+                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+--SUBJ:V_PASS-N-+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
COMP:V-N(by) (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V_PASS-N (increase,site)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 25
           +--------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------+                                 
           |                                                             +-----------------------OBJ:V-N----------------------+                |                                 
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                         |                |                                 
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                +----------OBJ:V-N----------+     
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+                +COMP:V-N(by+       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (increase,decrease)
COMP:V-N(by) (increase,__SP__)
OBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 26
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           |                                                             +-----------------------------------COMP:V-N(by)----------------------------------+       |             
           |                                                             +-----------------------OBJ:V-N----------------------+                            |       |             
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+---------------SUBJ:V_PASS-N--------------+           |       |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+--SUBJ:V_PASS-N-+           |       |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
COMP:V-N(by) (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
SUBJ:V_PASS-N (increase,site)
SUBJ:V_PASS-N (increase,protein)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 27
           +--------------------------------------------------------------------------COMP:V-N(by)-------------------------------------------------------------------------+     
           |        +-------------------------------------------------------SUBJ:V_PASS-N------------------------------------------------------+                           |     
           |        |                                                    +-----------------------OBJ:V-N----------------------+                |                           |     
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+--------------SUBJ:V-N--------------+     |                           |     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+          |     |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:V-N(by) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,site)
SUBJ:V-N (be,protein)
SUBJ:V_PASS-N (increase,bind)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 28
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           +-----------------------------------------------------------SUBJ:V_PASS-N-----------------------------------------------------------+                   |             
           |                                                             +-----------------------OBJ:V-N----------------------+                |                   |             
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                         |                |                   |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |                   |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+                +COMP:V_PASS+       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V_PASS-N (increase,decrease)
COMP:V_PASS-N(by) (increase,__SP__)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 29
           +-------------------------------------------------SUBJ:V-N-------------------------------------------------+                                                          
           |                                                             +---------------OBJ:V-N--------------+       |                                                          
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+         |       |                        +-----COMP:V_PASS-N(by)-----+     
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         |       |       +--SUBJ:V_PASS-N-+           +-MOD_ATT:N-ADJ-+     
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +OBJ:V-N+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)
SUBJ:V-N (be,protein)
SUBJ:V_PASS-N (increase,protein)
COMP:V_PASS-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 30
           +--------------------------------------------------------------------------COMP:V-N(by)-------------------------------------------------------------------------+     
           |                                                             +-----------------------OBJ:V-N----------------------+                                            |     
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                                            |     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                            +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+--SUBJ:V_PASS-N-+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:V-N(by) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 31
           +--------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------+                                 
           |                                                             +-----------------------OBJ:V-N----------------------+                |                                 
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                         |                |                                 
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                +----------OBJ:V-N----------+     
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     +COMP:V-N(by+       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
SUBJ:V-N (increase,decrease)
COMP:V-N(by) (increase,__SP__)
OBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 32
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           +-----------------------------------------------------------SUBJ:V_PASS-N-----------------------------------------------------------+                   |             
           |                                                             +-----------------------OBJ:V-N----------------------+                |                   |             
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                         |                |                   |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |                   |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     +COMP:V_PASS+       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
SUBJ:V_PASS-N (increase,decrease)
COMP:V_PASS-N(by) (increase,__SP__)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 33
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           +------------------------------------------------------------------COMP:N-N(by)-----------------------------------------------------------------+       |             
           |                                                             +---------------OBJ:V-N--------------+                                            |       |             
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+------------------OBJ:V-N-----------------+           |       |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         +-------------OBJ:V-N------------+           |       |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+----SUBJ:V-N----+           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
COMP:N-N(by) (decrease,__SP__)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,site)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 34
                                                                         +-------------------------------------------COMP:V-N(by)------------------------------------------+     
                                                                         +-----------------------OBJ:V-N----------------------+                                            |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                                            |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                            +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+--SUBJ:V_PASS-N-+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
COMP:V-N(by) (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 35
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           |                                                             +-----------------------------------COMP:V-N(by)----------------------------------+       |             
           |                                                             +-----------------------OBJ:V-N----------------------+                            |       |             
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                         |                            |       |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                            |       |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+--SUBJ:V_PASS-N-+           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
COMP:V-N(by) (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V_PASS-N (increase,protein)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 36
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           +------------------------------------------------------------------COMP:N-N(by)-----------------------------------------------------------------+       |             
           |                                                             +-------------------OBJ:V-N------------------+                                    |       |             
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 +---------OBJ:V-N--------+           |       |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |       +----SUBJ:V-N----+           |       |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +-SUBJ:V-N-+     |           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
COMP:N-N(by) (decrease,__SP__)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 37
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           +------------------------------------------------------------------COMP:N-N(by)-----------------------------------------------------------------+       |             
           |                                                                                        +------------------OBJ:V-N-----------------+           |       |             
           |                                                             +---------------OBJ:V-N--------------+                                |           |       |             
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+         +-------------OBJ:V-N------------+           |       |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         |               +----SUBJ:V-N----+           |       |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
COMP:N-N(by) (decrease,__SP__)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,site)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 38
                                                                         +-----------------------OBJ:V-N----------------------+                                                  
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                +-----COMP:V_PASS-N(by)-----+     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+--SUBJ:V_PASS-N-+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V_PASS-N (increase,protein)
COMP:V_PASS-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 39
                    +-------------------------------------------------------SUBJ:V_PASS-N------------------------------------------------------+                                 
           +------------------------------------------------------OBJ:V-N-----------------------------------------------------+                |                                 
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                +-----COMP:V_PASS-N(by)-----+     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+--SUBJ:V_PASS-N-+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
OBJ:V-N (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V_PASS-N (increase,bind)
SUBJ:V_PASS-N (increase,protein)
COMP:V_PASS-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 40
           +--------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------+                                 
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                                          |                                 
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                +----------OBJ:V-N----------+     
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+----SUBJ:V-N----+COMP:V-N(by+       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (increase,decrease)
SUBJ:V-N (increase,protein)
COMP:V-N(by) (increase,__SP__)
OBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 41
                    +---------------------------------------------SUBJ:V-N--------------------------------------------+                                                          
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 +--------------------COMP:V-N(by)--------------------+     
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |                                    +-MOD_ATT:N-ADJ-+     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+--SUBJ:V_PASS-N-+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)
COMP:V-N(by) (__NODE__,protein)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 42
           +-------------------------------------------------SUBJ:V-N-------------------------------------------------+                                                          
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 +--------------------COMP:V-N(by)--------------------+     
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |                                    +-MOD_ATT:N-ADJ-+     
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+--SUBJ:V_PASS-N-+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
SUBJ:V-N (__NODE__,decrease)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)
COMP:V-N(by) (__NODE__,protein)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 43
           +-------------------------------------------------SUBJ:V-N-------------------------------------------------+                                                          
           |                                                             +---------------OBJ:V-N--------------+       |                                                          
           |                                                             +----------OBJ:V-N---------+         |       |                                                          
           |                                                             |           +------MOD_ATT:N-ADJ-----+       |                                                          
           +---------------------------SUBJ:V-N--------------------------+           |       +--MOD_ATT:N-ADJ-+       |       +----------------COMP:N-N(by)----------------+     
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         |       |       |                            +-MOD_ATT:N-ADJ-+     
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +OBJ:V-N+--SUBJ:V_PASS-N-+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__SP__,__NODE__)
MOD_ATT:N-ADJ (__SP__,binding)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)
COMP:N-N(by) (protein,protein)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 44
                    +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+                                 
                    |                                                    +---------------OBJ:V-N--------------+                                |                                 
                    |                                                    +----------OBJ:V-N---------+         |                                |                                 
                    |                                                    |           +------MOD_ATT:N-ADJ-----+                                |                                 
                    +----------------------SUBJ:V-N----------------------+           |       +--MOD_ATT:N-ADJ-+                                +--------COMP:V-N(by)-------+     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |                                |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+----SUBJ:V-N----+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__SP__,__NODE__)
MOD_ATT:N-ADJ (__SP__,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,bind)
SUBJ:V-N (increase,protein)
COMP:V-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 45
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           +--------------------------------------------------------------OBJ:V-N--------------------------------------------------------------+                   |             
           |        +---------------------------------------------------------SUBJ:V-N---------------------------------------------------------+                   |             
           +---------------------------OBJ:V-N---------------------------+-----------------------OBJ:V-N----------------------+                |                   |             
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+--------------SUBJ:V-N--------------+     |                   |             
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+          |     |                   |             
   +MOD_ATT+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     +COMP:V-N(by+       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,decrease)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,site)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,decrease)
SUBJ:V-N (increase,bind)
COMP:V-N(by) (increase,__SP__)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 46
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           +------------------------------------------------------------------COMP:N-N(by)-----------------------------------------------------------------+       |             
           +-----------------------------------------------------------SUBJ:V_PASS-N-----------------------------------------------------------+           |       |             
           |                                                             +-----------------------OBJ:V-N----------------------+                |           |       |             
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                         |                |           |       |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           |       |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+                |           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
COMP:N-N(by) (decrease,__SP__)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V_PASS-N (increase,decrease)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 47
                    +---------------------------------------------------------------------COMP:N-N(by)---------------------------------------------------------------------+     
                    |                                                    +-----------------------OBJ:V-N----------------------+                                            |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+---------------SUBJ:V_PASS-N--------------+                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+--SUBJ:V_PASS-N-+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
COMP:N-N(by) (bind,protein)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V_PASS-N (increase,site)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 48
                    +---------------------------------------------------------------------COMP:N-N(by)---------------------------------------------------------------------+     
                    |                                                    +-----------------------OBJ:V-N----------------------+                                            |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+---------------SUBJ:V_PASS-N--------------+                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+--SUBJ:V_PASS-N-+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
COMP:N-N(by) (bind,protein)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V_PASS-N (increase,site)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 49
           +--------------------------------------------------------------------------COMP:V-N(by)-------------------------------------------------------------------------+     
           |                                                             +-------------------OBJ:V-N------------------+                                                    |     
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+------------------OBJ:V-N-----------------+                           |     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 +---------OBJ:V-N--------+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +----SUBJ:V-N----+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:V-N(by) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (increase,site)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 50
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           +--------------------------------------------------------------OBJ:V-N--------------------------------------------------------------+                   |             
           |                                                             +-------------------------------SUBJ:V-N------------------------------+                   |             
           |                                                             +-----------------------OBJ:V-N----------------------+                |                   |             
           |                                                             +----------OBJ:V-N---------+                         |                |                   |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |                   |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+                +COMP:V-N(by+       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,decrease)
SUBJ:V-N (increase,contain)
COMP:V-N(by) (increase,__SP__)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 51
           +--------------------------------------------------------------------------COMP:V-N(by)-------------------------------------------------------------------------+     
           |        +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+                           |     
           |        |                                                    +-------------------------------SUBJ:V-N------------------------------+                           |     
           |        |                                                    +-----------------------OBJ:V-N----------------------+                |                           |     
           |        |                                                    +----------OBJ:V-N---------+                         |                |                           |     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+                |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:V-N(by) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,bind)
SUBJ:V-N (increase,contain)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 52
           +--------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------+                     
           +--------------------------------------------------------------OBJ:V-N--------------------------------------------------------------+           |                     
           |                                                             +-------------------------------SUBJ:V-N------------------------------+           |                     
           |                                                             +-----------------------OBJ:V-N----------------------+                |           |                     
           |                                                             +----------OBJ:V-N---------+--------------SUBJ:V-N--------------+     |           |                     
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+          |     |           +----OBJ:V-N----+     
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     +MOD:V-+    |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |      |    |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,site)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,decrease)
SUBJ:V-N (increase,contain)
MOD:V-ADV (increase,by)
SUBJ:V-N (__SP__,decrease)
OBJ:V-N (__SP__,protein)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 53
                                                                                                    +------------------OBJ:V-N-----------------+                                 
                                                                         +---------------OBJ:V-N--------------+                                |                                 
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         +-------------OBJ:V-N------------+--------COMP:V-N(by)-------+     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |               +----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,site)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
COMP:V-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 54
                                                                         +-------------------------------------------COMP:V-N(by)------------------------------------------+     
                                                                         +-------------------OBJ:V-N------------------+                                                    |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |                                                    |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 +---------OBJ:V-N--------+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +----SUBJ:V-N----+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__NODE__)
COMP:V-N(by) (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 55
                                                                         +-------------------------------------------COMP:V-N(by)------------------------------------------+     
                                                                         +---------------OBJ:V-N--------------+                                                            |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         +-------------OBJ:V-N------------+                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |               +----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
COMP:V-N(by) (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 56
                                                                         +-------------------------------------------COMP:V-N(by)------------------------------------------+     
                                                                         +-------------------OBJ:V-N------------------+                                                    |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+------------------OBJ:V-N-----------------+                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 +---------OBJ:V-N--------+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +----SUBJ:V-N----+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__NODE__)
COMP:V-N(by) (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (increase,site)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 57
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           |                                                             +-----------------------OBJ:V-N----------------------+                                    |             
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+---------------------COMP:N-N(by)---------------------+       |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+--------COMP:N-N(by)--------+       |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+--SUBJ:V_PASS-N-+           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:N-N(by) (site,__SP__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:N-N(by) (protein,__SP__)
SUBJ:V_PASS-N (increase,protein)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 58
           +--------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------+                     
           |                                                             +-------------------OBJ:V-N------------------+                                    |                     
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+------------------OBJ:V-N-----------------+           |                     
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 +---------OBJ:V-N--------+           +----OBJ:V-N----+     
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +----SUBJ:V-N----+MOD:V-+    |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |      |    |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (increase,site)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
MOD:V-ADV (increase,by)
SUBJ:V-N (__SP__,decrease)
OBJ:V-N (__SP__,protein)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 59
                    +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+                                 
                    |                                                    +-------------------OBJ:V-N------------------+                        |                                 
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |                        +--------COMP:V-N(by)-------+     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |                        |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +----SUBJ:V-N----+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (increase,bind)
SUBJ:V-N (increase,protein)
COMP:V-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 60
                    +---------------------------------------------------------------------COMP:N-N(by)---------------------------------------------------------------------+     
                    +-------------------------------------------------------SUBJ:V_PASS-N------------------------------------------------------+                           |     
                    |                                                    +-----------------------OBJ:V-N----------------------+                |                           |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                |                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+                |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
COMP:N-N(by) (bind,protein)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V_PASS-N (increase,bind)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 61
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           |                                                             +-----------------------------------COMP:V-N(by)----------------------------------+       |             
           |                                                             +---------------OBJ:V-N--------------+                                            |       |             
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+------------------OBJ:V-N-----------------+           |       |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         +-------------OBJ:V-N------------+           |       |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+----SUBJ:V-N----+           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
COMP:V-N(by) (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,site)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 62
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           |                                                             +-----------------------------------COMP:V-N(by)----------------------------------+       |             
           |                                                             +-------------------OBJ:V-N------------------+                                    |       |             
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+------------------OBJ:V-N-----------------+           |       |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 +---------OBJ:V-N--------+           |       |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +----SUBJ:V-N----+           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__NODE__)
COMP:V-N(by) (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (increase,site)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 63
           +--------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------+                     
           +--------------------------------------------------------------OBJ:V-N--------------------------------------------------------------+           |                     
           |                                                             +-------------------OBJ:V-N------------------+                        |           |                     
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |                        |           |                     
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |       +----SUBJ:V-N----+           +----OBJ:V-N----+     
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +-SUBJ:V-N-+     +MOD:V-+    |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |      |    |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,decrease)
SUBJ:V-N (increase,protein)
MOD:V-ADV (increase,by)
SUBJ:V-N (__SP__,decrease)
OBJ:V-N (__SP__,protein)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 64
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           +------------------------------------------------------------------COMP:N-N(by)-----------------------------------------------------------------+       |             
           +-----------------------------------------------------------SUBJ:V_PASS-N-----------------------------------------------------------+           |       |             
           |                                                             +-----------------------OBJ:V-N----------------------+                |           |       |             
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                         |                |           |       |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           |       |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+                |           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
COMP:N-N(by) (decrease,__SP__)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V_PASS-N (increase,decrease)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 65
                                                                         +---------------OBJ:V-N--------------+                                                                  
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+------------------OBJ:V-N-----------------+--------COMP:V-N(by)-------+     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-------------OBJ:V-N------------+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+----SUBJ:V-N----+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,site)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
COMP:V-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 66
           +-------------------------------------------------SUBJ:V-N-------------------------------------------------+                                                          
           |                                                             +---------------OBJ:V-N--------------+       |                                                          
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+         |       |       +----------------COMP:N-N(by)----------------+     
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         |       |       |                            +-MOD_ATT:N-ADJ-+     
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +OBJ:V-N+--SUBJ:V_PASS-N-+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)
COMP:N-N(by) (protein,protein)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 67
           +--------------------------------------------------------------------------COMP:V-N(by)-------------------------------------------------------------------------+     
           |                                                             +-------------------OBJ:V-N------------------+                                                    |     
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |                                                    |     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 +---------OBJ:V-N--------+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +----SUBJ:V-N----+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:V-N(by) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 68
           +--------------------------------------------------------------------------COMP:V-N(by)-------------------------------------------------------------------------+     
           |                                                                                        +------------------OBJ:V-N-----------------+                           |     
           |                                                             +---------------OBJ:V-N--------------+                                |                           |     
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         +-------------OBJ:V-N------------+                           |     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |               +----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:V-N(by) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,site)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 69
           +--------------------------------------------------OBJ:V-N-------------------------------------------------+                                                          
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 +---------OBJ:V-N--------+--------COMP:V-N(by)-------+     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |       +----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
OBJ:V-N (decrease,__NODE__)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
COMP:V-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 70
           +----------------------------------------------OBJ:V-N---------------------------------------------+                                                                  
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         |                                +--------COMP:V-N(by)-------+     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-------------OBJ:V-N------------+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+----SUBJ:V-N----+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
OBJ:V-N (decrease,__SP__)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
COMP:V-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 71
           +--------------------------------------------------------------------------COMP:V-N(by)-------------------------------------------------------------------------+     
           |        +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+                           |     
           |        |                                                    +---------------OBJ:V-N--------------+                                |                           |     
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         |                                |                           |     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |               +----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:V-N(by) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,bind)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 72
           +--------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------+                     
           +--------------------------------------------------------------OBJ:V-N--------------------------------------------------------------+           |                     
           |                                                             +---------------OBJ:V-N--------------+                                |           |                     
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+         |                                |           |                     
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         |                                |           +----OBJ:V-N----+     
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+----SUBJ:V-N----+MOD:V-+    |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |      |    |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,decrease)
SUBJ:V-N (increase,protein)
MOD:V-ADV (increase,by)
SUBJ:V-N (__SP__,decrease)
OBJ:V-N (__SP__,protein)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 73
           +--------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------+                     
           |                                                             +-------------------OBJ:V-N------------------+                                    |                     
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |                                    |                     
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 +---------OBJ:V-N--------+           +----OBJ:V-N----+     
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +----SUBJ:V-N----+MOD:V-+    |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |      |    |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
MOD:V-ADV (increase,by)
SUBJ:V-N (__SP__,decrease)
OBJ:V-N (__SP__,protein)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 74
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           |                                                             +-----------------------OBJ:V-N----------------------+                                    |             
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                         +--------COMP:N-N(by)--------+       |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+--SUBJ:V_PASS-N-+           |       |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:N-N(by) (protein,__SP__)
SUBJ:V-N (be,protein)
SUBJ:V_PASS-N (increase,protein)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 75
                                                                         +-------------------------------------------COMP:V-N(by)------------------------------------------+     
                                                                         +---------------OBJ:V-N--------------+                                                            |     
                                                                         +----------OBJ:V-N---------+         |                                                            |     
                                                                         |           +------MOD_ATT:N-ADJ-----+                                                            |     
                    +----------------------SUBJ:V-N----------------------+           |       +--MOD_ATT:N-ADJ-+-------------OBJ:V-N------------+                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |               +----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
COMP:V-N(by) (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__SP__,__NODE__)
MOD_ATT:N-ADJ (__SP__,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 76
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           |                                                             +-------------------OBJ:V-N------------------+                                            |             
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 +---------OBJ:V-N--------+                   |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |       +----SUBJ:V-N----+                   |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +-SUBJ:V-N-+     +COMP:V-N(by+       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
COMP:V-N(by) (increase,__SP__)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 77
                                                                         +---------------OBJ:V-N--------------+                                                                  
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         +-------------OBJ:V-N------------+--------COMP:V-N(by)-------+     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |               +----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
COMP:V-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 78
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+         +----------------------SUBJ:V-N----------------------+             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         +-------------OBJ:V-N------------+                   |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+----SUBJ:V-N----+COMP:V-N(by+       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
COMP:V-N(by) (increase,__SP__)
SUBJ:V-N (__NODE__,decrease)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 79
                    +---------------------------------------------------------------SUBJ:V-N---------------------------------------------------------------+                     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                                                      |                     
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+----------SUBJ:V-N----------+----OBJ:V-N----+     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+                +MOD:V_+    |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |      |    |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD:V_PASS-ADV (increase,by)
SUBJ:V-N (__SP__,bind)
SUBJ:V-N (__SP__,protein)
OBJ:V-N (__SP__,protein)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 80
           +--------------------------------------------------------------------------COMP:V-N(by)-------------------------------------------------------------------------+     
           |        +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+                           |     
           +----------------------------------------------OBJ:V-N---------------------------------------------+                                |                           |     
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         +-------------OBJ:V-N------------+                           |     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |               +----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
OBJ:V-N (decrease,__SP__)
COMP:V-N(by) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,bind)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 81
           +-------------------------------------------------SUBJ:V-N-------------------------------------------------+                                                          
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |       +----------------COMP:N-N(by)----------------+     
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |       |                            +-MOD_ATT:N-ADJ-+     
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+--SUBJ:V_PASS-N-+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
SUBJ:V-N (__NODE__,decrease)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)
COMP:N-N(by) (protein,protein)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 82
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           |                                                             +-----------------------OBJ:V-N----------------------+                                    |             
           |                                                             |                          +---------------SUBJ:V_PASS-N--------------+                   |             
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+--------------SUBJ:V-N--------------+     |                   |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+--SUBJ:V_PASS-N-+                   |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     +COMP:V_PASS+       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,site)
SUBJ:V-N (be,protein)
SUBJ:V_PASS-N (increase,site)
SUBJ:V_PASS-N (increase,protein)
COMP:V_PASS-N(by) (increase,__SP__)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 83
           +--------------------------------------------------------------------------COMP:V-N(by)-------------------------------------------------------------------------+     
           |        +-------------------------------------------------------SUBJ:V_PASS-N------------------------------------------------------+                           |     
           |        |                                                    +-----------------------OBJ:V-N----------------------+                |                           |     
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+--------------SUBJ:V-N--------------+     |                           |     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+          |     |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:V-N(by) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,site)
SUBJ:V-N (be,protein)
SUBJ:V_PASS-N (increase,bind)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 84
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           +------------------------------------------------------------------COMP:N-N(by)-----------------------------------------------------------------+       |             
           +--------------------------------------------------------------OBJ:V-N--------------------------------------------------------------+           |       |             
           |                                                             +---------------OBJ:V-N--------------+                                |           |       |             
           |                                                             +----------OBJ:V-N---------+         |                                |           |       |             
           |                                                             |           +------MOD_ATT:N-ADJ-----+                                |           |       |             
           +---------------------------SUBJ:V-N--------------------------+           |       +--MOD_ATT:N-ADJ-+                                |           |       |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         |                                |           |       |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+----SUBJ:V-N----+           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
COMP:N-N(by) (decrease,__SP__)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__SP__,__NODE__)
MOD_ATT:N-ADJ (__SP__,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,decrease)
SUBJ:V-N (increase,protein)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 85
                    +-------------------------------------------------------SUBJ:V_PASS-N------------------------------------------------------+                                 
                    |                                                    +-----------------------OBJ:V-N----------------------+                |                                 
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                +-----COMP:V_PASS-N(by)-----+     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
SUBJ:V_PASS-N (increase,bind)
COMP:V_PASS-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 86
                    +---------------------------------------------------------SUBJ:V-N---------------------------------------------------------+                                 
                    |                                                    +-----------------------OBJ:V-N----------------------+                |                                 
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                +--------COMP:V-N(by)-------+     
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           +-MOD_ATT:N-ADJ-+     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+                |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (increase,bind)
COMP:V-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 87
                    +-------------------------------------------------------SUBJ:V_PASS-N------------------------------------------------------+                                 
                    |                                                    +-----------------------OBJ:V-N----------------------+                |                                 
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                +-----COMP:V_PASS-N(by)-----+     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+                |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V_PASS-N (increase,bind)
COMP:V_PASS-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 88
                    +---------------------------------------------------------SUBJ:V-N---------------------------------------------------------+                                 
                    |                                                    +-----------------------OBJ:V-N----------------------+                |                                 
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+--------------SUBJ:V-N--------------+     +--------COMP:V-N(by)-------+     
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+          |     |           +-MOD_ATT:N-ADJ-+     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,site)
SUBJ:V-N (be,protein)
SUBJ:V-N (increase,bind)
COMP:V-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 89
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           +------------------------------------------------------------------COMP:N-N(by)-----------------------------------------------------------------+       |             
           |                                                             +-------------------OBJ:V-N------------------+                                    |       |             
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+------------------OBJ:V-N-----------------+           |       |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 +---------OBJ:V-N--------+           |       |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +----SUBJ:V-N----+           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
COMP:N-N(by) (decrease,__SP__)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (increase,site)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 90
                    +---------------------------------------------------------SUBJ:V-N---------------------------------------------------------+                                 
                    +------------------------------------------------------SUBJ:V-N------------------------------------------------------+     |                                 
                    |                                                    +-----------------------OBJ:V-N----------------------+          |     |                                 
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |          |     +--------COMP:V-N(by)-------+     
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+          |     |           +-MOD_ATT:N-ADJ-+     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+          |     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,bind)
SUBJ:V-N (increase,bind)
COMP:V-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 91
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           +------------------------------------------------------------------COMP:N-N(by)-----------------------------------------------------------------+       |             
           +--------------------------------------------------------------OBJ:V-N--------------------------------------------------------------+           |       |             
           |                                                             +-------------------OBJ:V-N------------------+                        |           |       |             
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |                        |           |       |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |                        |           |       |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +----SUBJ:V-N----+           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
COMP:N-N(by) (decrease,__SP__)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (increase,decrease)
SUBJ:V-N (increase,protein)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 92
                    +-------------------------------------------------------SUBJ:V_PASS-N------------------------------------------------------+                                 
                    |                                                    +-----------------------OBJ:V-N----------------------+                |                                 
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                +-----COMP:V_PASS-N(by)-----+     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
SUBJ:V_PASS-N (increase,bind)
COMP:V_PASS-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 93
           +--------------------------------------------------------------------------COMP:V-N(by)-------------------------------------------------------------------------+     
           |                                                             +-----------------------OBJ:V-N----------------------+                                            |     
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                                            |     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                            +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+--SUBJ:V_PASS-N-+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:V-N(by) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 94
           +-------------------------------------------------SUBJ:V-N-------------------------------------------------+                                                          
           |                                                             +---------------OBJ:V-N--------------+       |                                                          
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+         |       +--------------------COMP:V-N(by)--------------------+     
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         |       |       +--SUBJ:V_PASS-N-+           +-MOD_ATT:N-ADJ-+     
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +OBJ:V-N+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)
COMP:V-N(by) (__NODE__,protein)
SUBJ:V-N (be,protein)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 95
                    +---------------------------------------------------------------------COMP:N-N(by)---------------------------------------------------------------------+     
                    |                                                    +---------------OBJ:V-N--------------+                                                            |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         +-------------OBJ:V-N------------+                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |               +----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
COMP:N-N(by) (bind,protein)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 96
           +--------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------+                                 
           |                                                             +-----------------------OBJ:V-N----------------------+                |                                 
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                         |                +----------OBJ:V-N----------+     
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                +----COMP:V-N(by)---+       |     
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+                |           +MOD_ATT+       |     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (increase,decrease)
COMP:V-N(by) (increase,__NODE__)
OBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (__NODE__,__SP__)

Analyse 97
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           +------------------------------------------------------------------COMP:N-N(by)-----------------------------------------------------------------+       |             
           |                                                             +-------------------OBJ:V-N------------------+                                    |       |             
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 +---------OBJ:V-N--------+           |       |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |       +----SUBJ:V-N----+           |       |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +-SUBJ:V-N-+     |           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
COMP:N-N(by) (decrease,__SP__)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 98
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           +------------------------------------------------------------------COMP:N-N(by)-----------------------------------------------------------------+       |             
           +--------------------------------------------------------------OBJ:V-N--------------------------------------------------------------+           |       |             
           |                                                             +-------------------OBJ:V-N------------------+                        |           |       |             
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |                        |           |       |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |       +----SUBJ:V-N----+           |       |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +-SUBJ:V-N-+     |           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
COMP:N-N(by) (decrease,__SP__)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,decrease)
SUBJ:V-N (increase,protein)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 99
           +-------------------------------------------------SUBJ:V-N-------------------------------------------------+                                                          
           |                                                             +---------------OBJ:V-N--------------+       |                                                          
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+         |       |                        +-----COMP:V_PASS-N(by)-----+     
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         |       |                        |           +-MOD_ATT:N-ADJ-+     
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +OBJ:V-N+--SUBJ:V_PASS-N-+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)
SUBJ:V_PASS-N (increase,protein)
COMP:V_PASS-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 100
           +-------------------------------------------------SUBJ:V-N-------------------------------------------------+                                                          
           |                                                             +---------------OBJ:V-N--------------+       |                                                          
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+         |       +--------------------COMP:V-N(by)--------------------+     
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         |       |                                    +-MOD_ATT:N-ADJ-+     
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +OBJ:V-N+--SUBJ:V_PASS-N-+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)
COMP:V-N(by) (__NODE__,protein)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 101
                    +---------------------------------------------------------------------COMP:N-N(by)---------------------------------------------------------------------+     
                    |                                                    +-------------------OBJ:V-N------------------+                                                    |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 +---------OBJ:V-N--------+                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |       +----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
COMP:N-N(by) (bind,protein)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 102
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           |                                                                                        +---------------------COMP:N-N(by)---------------------+       |             
           |                                                             +-------------------OBJ:V-N------------------+------------COMP:N-N(by)------------+       |             
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 +---------OBJ:V-N--------+           |       |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |       +----SUBJ:V-N----+           |       |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +-SUBJ:V-N-+     |           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:N-N(by) (site,__SP__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(by) (__NODE__,__SP__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 103
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                                          +----------OBJ:V-N----------+     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                +----COMP:V-N(by)---+       |     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+----SUBJ:V-N----+           +MOD_ATT+       |     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (increase,protein)
COMP:V-N(by) (increase,__NODE__)
OBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (__NODE__,__SP__)

Analyse 104
                    +-------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------+             
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                                                              |             
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+--------------SUBJ:V-N--------------+             
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+--SUBJ:V_PASS-N-+COMP:V_PASS+       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V_PASS-N (increase,protein)
COMP:V_PASS-N(by) (increase,__SP__)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,protein)
OBJ:V-N (__NODE__,protein)

Analyse 105
           +--------------------------------------------------------------------------COMP:V-N(by)-------------------------------------------------------------------------+     
           +------------------------------------------------------OBJ:V-N-----------------------------------------------------+                                            |     
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                                            |     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                            +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+--SUBJ:V_PASS-N-+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
OBJ:V-N (decrease,protein)
COMP:V-N(by) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 106
                    +---------------------------------------------------------SUBJ:V-N---------------------------------------------------------+                                 
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                                          +--------COMP:V-N(by)-------+     
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
SUBJ:V-N (increase,bind)
SUBJ:V-N (increase,protein)
COMP:V-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 107
                    +---------------------------------------------------------SUBJ:V-N---------------------------------------------------------+                                 
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                                          +--------COMP:V-N(by)-------+     
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           +-MOD_ATT:N-ADJ-+     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+----SUBJ:V-N----+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (increase,bind)
SUBJ:V-N (increase,protein)
COMP:V-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 108
                    +---------------------------------------------------------SUBJ:V-N---------------------------------------------------------+                                 
                    +------------------------------------------------------SUBJ:V-N------------------------------------------------------+     |                                 
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                                    |     +--------COMP:V-N(by)-------+     
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,bind)
SUBJ:V-N (be,protein)
SUBJ:V-N (increase,bind)
SUBJ:V-N (increase,protein)
COMP:V-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 109
                    +-------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------+             
                    +-------------------------------------------------------SUBJ:V_PASS-N------------------------------------------------------+                   |             
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                                          |                   |             
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+--------------SUBJ:V-N--------------+             
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+--SUBJ:V_PASS-N-+COMP:V_PASS+       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V_PASS-N (increase,bind)
SUBJ:V_PASS-N (increase,protein)
COMP:V_PASS-N(by) (increase,__SP__)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,protein)
OBJ:V-N (__NODE__,protein)

Analyse 110
           +--------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------+                                 
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                                          |                                 
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                +----------OBJ:V-N----------+     
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+----SUBJ:V-N----+COMP:V-N(by+       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (increase,decrease)
SUBJ:V-N (increase,protein)
COMP:V-N(by) (increase,__SP__)
OBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 111
                    +---------------------------------------------SUBJ:V-N--------------------------------------------+                                                          
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |                        +-----COMP:V_PASS-N(by)-----+     
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |                        |           +-MOD_ATT:N-ADJ-+     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+--SUBJ:V_PASS-N-+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)
SUBJ:V_PASS-N (increase,protein)
COMP:V_PASS-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 112
                                                                         +---------------OBJ:V-N--------------+                                                                  
                                                                         +----------OBJ:V-N---------+------------------OBJ:V-N-----------------+                                 
                                                                         |           +------MOD_ATT:N-ADJ-----+                                |                                 
                    +----------------------SUBJ:V-N----------------------+           |       +--MOD_ATT:N-ADJ-+-------------OBJ:V-N------------+--------COMP:V-N(by)-------+     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |               +----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__SP__,__NODE__)
MOD_ATT:N-ADJ (__SP__,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,site)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
COMP:V-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 113
                    +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+                                 
                    |                                                    +-------------------------------SUBJ:V-N------------------------------+                                 
                    |                                                    +-----------------------OBJ:V-N----------------------+                |                                 
                    |                                                    +----------OBJ:V-N---------+                         |                +--------COMP:V-N(by)-------+     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+                |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,bind)
SUBJ:V-N (increase,contain)
COMP:V-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 114
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           |                                                                                        +---------------------COMP:N-N(by)---------------------+       |             
           |                                                             +-----------------------OBJ:V-N----------------------+                            |       |             
           |                                                             |                          +---------------SUBJ:V_PASS-N--------------+           |       |             
           |                                                             |                          +--------------SUBJ:V-N--------------+     |           |       |             
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                         +--------COMP:N-N(by)--------+       |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+--SUBJ:V_PASS-N-+           |       |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:N-N(by) (site,__SP__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:N-N(by) (protein,__SP__)
SUBJ:V-N (be,site)
SUBJ:V-N (be,protein)
SUBJ:V_PASS-N (increase,site)
SUBJ:V_PASS-N (increase,protein)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 115
           +--------------------------------------------------------------------------COMP:V-N(by)-------------------------------------------------------------------------+     
           |        +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+                           |     
           |        |                                                    +-------------------------------SUBJ:V-N------------------------------+                           |     
           |        |                                                    +-----------------------OBJ:V-N----------------------+                |                           |     
           |        |                                                    +----------OBJ:V-N---------+--------------SUBJ:V-N--------------+     |                           |     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+          |     |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:V-N(by) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,site)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,bind)
SUBJ:V-N (increase,contain)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 116
           +--------------------------------------------------------------------------COMP:V-N(by)-------------------------------------------------------------------------+     
           |        +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+                           |     
           |        |                                                    +-------------------------------SUBJ:V-N------------------------------+                           |     
           |        |                                                    +-----------------------OBJ:V-N----------------------+                |                           |     
           |        |                                                    +----------OBJ:V-N---------+--------------SUBJ:V-N--------------+     |                           |     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+          |     |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:V-N(by) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,site)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,bind)
SUBJ:V-N (increase,contain)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 117
           +--------------------------------------------------------------------------COMP:V-N(by)-------------------------------------------------------------------------+     
           |        +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+                           |     
           |        |                                                    +-------------------------------SUBJ:V-N------------------------------+                           |     
           |        |                                                    +-----------------------OBJ:V-N----------------------+                |                           |     
           |        |                                                    +----------OBJ:V-N---------+                         |                |                           |     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+                |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:V-N(by) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,bind)
SUBJ:V-N (increase,contain)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 118
                    +---------------------------------------------------------------------COMP:N-N(by)---------------------------------------------------------------------+     
                    +-------------------------------------------------------SUBJ:V_PASS-N------------------------------------------------------+                           |     
                    +------------------------------------------------------SUBJ:V-N------------------------------------------------------+     |                           |     
                    |                                                    +-----------------------OBJ:V-N----------------------+          |     |                           |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |          |     |                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+          |     |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+          |     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
COMP:N-N(by) (bind,protein)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,bind)
SUBJ:V_PASS-N (increase,bind)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 119
                                                                         +---------------OBJ:V-N--------------+                                                                  
                                                                         +----------OBJ:V-N---------+------------------OBJ:V-N-----------------+                                 
                    +----------------------SUBJ:V-N----------------------+           +------MOD_ATT:N-ADJ-----+                                +--------COMP:V-N(by)-------+     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-------------OBJ:V-N------------+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+----SUBJ:V-N----+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__SP__,__NODE__)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,site)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
COMP:V-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 120
                                                                         +-------------------OBJ:V-N------------------+                                                          
                                                                         |                          +------------------OBJ:V-N-----------------+                                 
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 +---------OBJ:V-N--------+--------COMP:V-N(by)-------+     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |       +----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,site)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
COMP:V-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 121
                    +---------------------------------------------------------------------COMP:N-N(by)---------------------------------------------------------------------+     
                    |                                                    +-----------------------OBJ:V-N----------------------+                                            |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+---------------SUBJ:V_PASS-N--------------+                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+--SUBJ:V_PASS-N-+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
COMP:N-N(by) (bind,protein)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V_PASS-N (increase,site)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 122
                    +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+                                 
                    |                                                    +-------------------------------SUBJ:V-N------------------------------+                                 
                    |                                                    +-----------------------OBJ:V-N----------------------+                |                                 
                    |                                                    +----------OBJ:V-N---------+                         |                +--------COMP:V-N(by)-------+     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+                |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,bind)
SUBJ:V-N (increase,contain)
COMP:V-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 123
           +--------------------------------------------------------------------------COMP:V-N(by)-------------------------------------------------------------------------+     
           |                                                             +-------------------OBJ:V-N------------------+                                                    |     
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+------------------OBJ:V-N-----------------+                           |     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 +---------OBJ:V-N--------+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +----SUBJ:V-N----+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:V-N(by) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (increase,site)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 124
                    +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+                                 
                    |                                                    +-------------------OBJ:V-N------------------+                        |                                 
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |                        +--------COMP:V-N(by)-------+     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |       +----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,bind)
SUBJ:V-N (increase,protein)
COMP:V-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 125
                    +---------------------------------------------------------------------COMP:N-N(by)---------------------------------------------------------------------+     
                    +-------------------------------------------------------SUBJ:V_PASS-N------------------------------------------------------+                           |     
                    |                                                    +-----------------------OBJ:V-N----------------------+                |                           |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                |                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+                |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
COMP:N-N(by) (bind,protein)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V_PASS-N (increase,bind)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 126
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           +------------------------------------------------------------------COMP:N-N(by)-----------------------------------------------------------------+       |             
           |                                                             +-----------------------OBJ:V-N----------------------+                            |       |             
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+---------------SUBJ:V_PASS-N--------------+           |       |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+--SUBJ:V_PASS-N-+           |       |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
COMP:N-N(by) (decrease,__SP__)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
SUBJ:V_PASS-N (increase,site)
SUBJ:V_PASS-N (increase,protein)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 127
           +--------------------------------------------------------------------------COMP:V-N(by)-------------------------------------------------------------------------+     
           |        +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+                           |     
           |        |                                                    +---------------OBJ:V-N--------------+                                |                           |     
           |        |                                                    +----------OBJ:V-N---------+         |                                |                           |     
           |        +----------------------SUBJ:V-N----------------------+           +------MOD_ATT:N-ADJ-----+                                |                           |     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |               +----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:V-N(by) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__SP__,__NODE__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,bind)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 128
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           +--------------------------------------------------------------OBJ:V-N--------------------------------------------------------------+                   |             
           |        +---------------------------------------------------------SUBJ:V-N---------------------------------------------------------+                   |             
           +---------------------------OBJ:V-N---------------------------+-----------------------OBJ:V-N----------------------+                |                   |             
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                |                   |             
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |                   |             
   +MOD_ATT+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     +COMP:V-N(by+       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,decrease)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,decrease)
SUBJ:V-N (increase,bind)
COMP:V-N(by) (increase,__SP__)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 129
           +--------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------+                     
           +--------------------------------------------------------------OBJ:V-N--------------------------------------------------------------+           |                     
           |        +---------------------------------------------------------SUBJ:V-N---------------------------------------------------------+           |                     
           +---------------------------OBJ:V-N---------------------------+-----------------------OBJ:V-N----------------------+                |           |                     
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                |           |                     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           +----OBJ:V-N----+     
   +MOD_ATT+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+                +MOD:V-+    |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |      |    |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,decrease)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,decrease)
SUBJ:V-N (increase,bind)
MOD:V-ADV (increase,by)
SUBJ:V-N (__SP__,decrease)
OBJ:V-N (__SP__,protein)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 130
           +--------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------+                     
           +--------------------------------------------------------------OBJ:V-N--------------------------------------------------------------+           |                     
           |        +---------------------------------------------------------SUBJ:V-N---------------------------------------------------------+           |                     
           +---------------------------OBJ:V-N---------------------------+-----------------------OBJ:V-N----------------------+                |           |                     
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                |           |                     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           +----OBJ:V-N----+     
   +MOD_ATT+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+                +MOD:V-+    |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |      |    |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,decrease)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,decrease)
SUBJ:V-N (increase,bind)
MOD:V-ADV (increase,by)
SUBJ:V-N (__SP__,decrease)
OBJ:V-N (__SP__,protein)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 131
           +--------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------+                     
           +--------------------------------------------------------------OBJ:V-N--------------------------------------------------------------+           |                     
           |        +---------------------------------------------------------SUBJ:V-N---------------------------------------------------------+           |                     
           +---------------------------OBJ:V-N---------------------------+-----------------------OBJ:V-N----------------------+                |           |                     
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                |           |                     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           +----OBJ:V-N----+     
   +MOD_ATT+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+                +MOD:V-+    |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |      |    |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,decrease)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,decrease)
SUBJ:V-N (increase,bind)
MOD:V-ADV (increase,by)
SUBJ:V-N (__SP__,decrease)
OBJ:V-N (__SP__,protein)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 132
           +--------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------+                     
           +--------------------------------------------------------------OBJ:V-N--------------------------------------------------------------+           |                     
           |        +---------------------------------------------------------SUBJ:V-N---------------------------------------------------------+           |                     
           |        +------------------------------------------------------SUBJ:V-N------------------------------------------------------+     |           |                     
           +---------------------------OBJ:V-N---------------------------+-----------------------OBJ:V-N----------------------+          |     |           |                     
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |          |     |           |                     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+          |     |           +----OBJ:V-N----+     
   +MOD_ATT+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+          |     +MOD:V-+    |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |      |    |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,decrease)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,bind)
OBJ:V-N (increase,decrease)
SUBJ:V-N (increase,bind)
MOD:V-ADV (increase,by)
SUBJ:V-N (__SP__,decrease)
OBJ:V-N (__SP__,protein)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 133
           +--------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------+                     
           +--------------------------------------------------------------OBJ:V-N--------------------------------------------------------------+           |                     
           |        +---------------------------------------------------------SUBJ:V-N---------------------------------------------------------+           |                     
           +---------------------------OBJ:V-N---------------------------+-----------------------OBJ:V-N----------------------+                |           |                     
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                |           |                     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           +----OBJ:V-N----+     
   +MOD_ATT+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+                +MOD:V-+    |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |      |    |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,decrease)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,decrease)
SUBJ:V-N (increase,bind)
MOD:V-ADV (increase,by)
SUBJ:V-N (__SP__,decrease)
OBJ:V-N (__SP__,protein)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 134
                                                                                                    +-----------------------------COMP:N-N(by)-----------------------------+     
                                                                         +-----------------------OBJ:V-N----------------------+                                            |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         +----------------COMP:N-N(by)----------------+     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                            +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+--SUBJ:V_PASS-N-+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:N-N(by) (site,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:N-N(by) (protein,protein)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 135
                                                                         +-------------------------------------------COMP:V-N(by)------------------------------------------+     
                                                                         +---------------OBJ:V-N--------------+                                                            |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         +-------------OBJ:V-N------------+                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |               +----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
COMP:V-N(by) (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 136
           +--------------------------------------------------------------------------COMP:V-N(by)-------------------------------------------------------------------------+     
           |                                                             +---------------OBJ:V-N--------------+                                                            |     
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         |                                                            |     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-------------OBJ:V-N------------+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+----SUBJ:V-N----+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:V-N(by) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 137
           +--------------------------------------------------------------------------COMP:V-N(by)-------------------------------------------------------------------------+     
           |                                                             +---------------OBJ:V-N--------------+                                                            |     
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         |                                                            |     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-------------OBJ:V-N------------+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+----SUBJ:V-N----+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:V-N(by) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 138
                    +---------------------------------------------------------------------COMP:N-N(by)---------------------------------------------------------------------+     
                    |                                                    +-----------------------OBJ:V-N----------------------+                                            |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+---------------SUBJ:V_PASS-N--------------+                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+--SUBJ:V_PASS-N-+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
COMP:N-N(by) (bind,protein)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
SUBJ:V_PASS-N (increase,site)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 139
           +--------------------------------------------------------------------------COMP:V-N(by)-------------------------------------------------------------------------+     
           |                                                                                        +------------------OBJ:V-N-----------------+                           |     
           |                                                             +---------------OBJ:V-N--------------+                                |                           |     
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         +-------------OBJ:V-N------------+                           |     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |               +----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:V-N(by) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,site)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 140
           +--------------------------------------------------------------------------COMP:V-N(by)-------------------------------------------------------------------------+     
           |                                                             +-------------------OBJ:V-N------------------+                                                    |     
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+------------------OBJ:V-N-----------------+                           |     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 +---------OBJ:V-N--------+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +----SUBJ:V-N----+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:V-N(by) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (increase,site)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 141
                    +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+                                 
                    |                                                    +---------------OBJ:V-N--------------+                                |                                 
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         |                                +--------COMP:V-N(by)-------+     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |               +----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,bind)
SUBJ:V-N (increase,protein)
COMP:V-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 142
           +--------------------------------------------------------------------------COMP:V-N(by)-------------------------------------------------------------------------+     
           |        +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+                           |     
           |        |                                                    +-------------------OBJ:V-N------------------+                        |                           |     
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |                        |                           |     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |                        |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +----SUBJ:V-N----+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:V-N(by) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (increase,bind)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 143
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           +--------------------------------------------------------------OBJ:V-N--------------------------------------------------------------+                   |             
           |        +---------------------------------------------------------SUBJ:V-N---------------------------------------------------------+                   |             
           +---------------------------OBJ:V-N---------------------------+-----------------------OBJ:V-N----------------------+                |                   |             
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                |                   |             
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |                   |             
   +MOD_ATT+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     +COMP:V-N(by+       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,decrease)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,decrease)
SUBJ:V-N (increase,bind)
COMP:V-N(by) (increase,__SP__)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 144
                                                                         +---------------OBJ:V-N--------------+                                                                  
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+------------------OBJ:V-N-----------------+--------COMP:V-N(by)-------+     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-------------OBJ:V-N------------+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+----SUBJ:V-N----+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,site)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
COMP:V-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 145
                    +---------------------------------------------------------------------COMP:N-N(by)---------------------------------------------------------------------+     
                    |                                                    +-----------------------OBJ:V-N----------------------+                                            |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                                            |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                            +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+--SUBJ:V_PASS-N-+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
COMP:N-N(by) (bind,protein)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 146
           +--------------------------------------------------------------------------COMP:V-N(by)-------------------------------------------------------------------------+     
           |                                                             +---------------OBJ:V-N--------------+                                                            |     
           |                                                             +----------OBJ:V-N---------+         |                                                            |     
           |                                                             |           +------MOD_ATT:N-ADJ-----+                                                            |     
           |        +----------------------SUBJ:V-N----------------------+           |       +--MOD_ATT:N-ADJ-+-------------OBJ:V-N------------+                           |     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |               +----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:V-N(by) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__SP__,__NODE__)
MOD_ATT:N-ADJ (__SP__,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 147
                                                                         +---------------OBJ:V-N--------------+                                                                  
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         |                                +--------COMP:V-N(by)-------+     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-------------OBJ:V-N------------+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+----SUBJ:V-N----+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
COMP:V-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 148
                                                                         +-----------------------OBJ:V-N----------------------+                                                  
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         +----------------COMP:N-N(by)----------------+     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+--SUBJ:V_PASS-N-+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:N-N(by) (protein,protein)
SUBJ:V-N (be,protein)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 149
                                                                         +-------------------OBJ:V-N------------------+                                                          
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 +---------OBJ:V-N--------+--------COMP:V-N(by)-------+     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |       +----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
COMP:V-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 150
                                                                         +-----------------------OBJ:V-N----------------------+                                                  
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         +----------------COMP:N-N(by)----------------+     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                            +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+--SUBJ:V_PASS-N-+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:N-N(by) (protein,protein)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 151
                    +-------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------+             
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 +------------------SUBJ:V-N------------------+             
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 +---------OBJ:V-N--------+                   |             
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +----SUBJ:V-N----+COMP:V-N(by+       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
COMP:V-N(by) (increase,__SP__)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__NODE__)
OBJ:V-N (__NODE__,protein)

Analyse 152
           +--------------------------------------------------------------------------COMP:V-N(by)-------------------------------------------------------------------------+     
           +----------------------------------------------OBJ:V-N---------------------------------------------+                                                            |     
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         |                                                            |     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-------------OBJ:V-N------------+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+----SUBJ:V-N----+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
OBJ:V-N (decrease,__SP__)
COMP:V-N(by) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 153
                    +---------------------------------------------------------------SUBJ:V-N---------------------------------------------------------------+                     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                                                      |                     
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+----------SUBJ:V-N----------+----OBJ:V-N----+     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+                +MOD:V_+    |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |      |    |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD:V_PASS-ADV (increase,by)
SUBJ:V-N (__SP__,bind)
SUBJ:V-N (__SP__,protein)
OBJ:V-N (__SP__,protein)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 154
           +--------------------------------------------------------------------------COMP:V-N(by)-------------------------------------------------------------------------+     
           |        +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+                           |     
           +----------------------------------------------OBJ:V-N---------------------------------------------+                                |                           |     
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         |                                |                           |     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-------------OBJ:V-N------------+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+----SUBJ:V-N----+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
OBJ:V-N (decrease,__SP__)
COMP:V-N(by) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,bind)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 155
                    +---------------------------------------------------------------SUBJ:V-N---------------------------------------------------------------+                     
                    +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+           |                     
                    |                                                                                                 +--------------SUBJ:V-N--------------+                     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 +---------OBJ:V-N--------+           |                     
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |       +----SUBJ:V-N----+           +----OBJ:V-N----+     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +-SUBJ:V-N-+     +MOD:V-+    |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |      |    |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,bind)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
MOD:V-ADV (increase,by)
SUBJ:V-N (__SP__,bind)
SUBJ:V-N (__SP__,__NODE__)
OBJ:V-N (__SP__,protein)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 156
                    +---------------------------------------------SUBJ:V-N--------------------------------------------+                                                          
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |       +----------------COMP:N-N(by)----------------+     
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |       |                            +-MOD_ATT:N-ADJ-+     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+--SUBJ:V_PASS-N-+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)
COMP:N-N(by) (protein,protein)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 157
                    +-------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------+             
                    +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+                   |             
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         +----------------------SUBJ:V-N----------------------+             
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-------------OBJ:V-N------------+                   |             
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+----SUBJ:V-N----+COMP:V-N(by+       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,bind)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
COMP:V-N(by) (increase,__SP__)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 158
                    +---------------------------------------------------------SUBJ:V-N---------------------------------------------------------+                                 
                    |                                                    +-----------------------OBJ:V-N----------------------+                |                                 
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+--------------SUBJ:V-N--------------+     +--------COMP:V-N(by)-------+     
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+          |     |           +-MOD_ATT:N-ADJ-+     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,site)
SUBJ:V-N (be,protein)
SUBJ:V-N (increase,bind)
COMP:V-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 159
                    +---------------------------------------------------------SUBJ:V-N---------------------------------------------------------+                                 
                    |                                                    +-----------------------OBJ:V-N----------------------+                |                                 
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+--------------SUBJ:V-N--------------+     +----------OBJ:V-N----------+     
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+          |     +----COMP:V-N(by)---+       |     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           +MOD_ATT+       |     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,site)
SUBJ:V-N (be,protein)
SUBJ:V-N (increase,bind)
COMP:V-N(by) (increase,__NODE__)
OBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (__NODE__,__SP__)

Analyse 160
                    +-------------------------------------------------------SUBJ:V_PASS-N------------------------------------------------------+                                 
                    +------------------------------------------------------SUBJ:V-N------------------------------------------------------+     |                                 
                    |                                                    +-----------------------OBJ:V-N----------------------+          |     |                                 
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |          |     +-----COMP:V_PASS-N(by)-----+     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+          |     |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+          |     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,bind)
SUBJ:V_PASS-N (increase,bind)
COMP:V_PASS-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 161
                    +---------------------------------------------------------------------COMP:N-N(by)---------------------------------------------------------------------+     
                    +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+                           |     
                    |                                                    +-------------------------------SUBJ:V-N------------------------------+                           |     
                    |                                                    +-----------------------OBJ:V-N----------------------+                |                           |     
                    |                                                    +----------OBJ:V-N---------+--------------SUBJ:V-N--------------+     |                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+          |     |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
COMP:N-N(by) (bind,protein)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,site)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,bind)
SUBJ:V-N (increase,contain)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 162
                    +---------------------------------------------------------SUBJ:V-N---------------------------------------------------------+                                 
                    +------------------------------------------------------SUBJ:V-N------------------------------------------------------+     |                                 
                    |                                                    +-----------------------OBJ:V-N----------------------+          |     |                                 
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |          |     +--------COMP:V-N(by)-------+     
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+          |     |           +-MOD_ATT:N-ADJ-+     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+          |     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,bind)
SUBJ:V-N (increase,bind)
COMP:V-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 163
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           +------------------------------------------------------------------COMP:N-N(by)-----------------------------------------------------------------+       |             
           +--------------------------------------------------------------OBJ:V-N--------------------------------------------------------------+           |       |             
           |                                                             +-------------------------------SUBJ:V-N------------------------------+           |       |             
           |                                                             +-----------------------OBJ:V-N----------------------+                |           |       |             
           |                                                             +----------OBJ:V-N---------+                         |                |           |       |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           |       |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+                |           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
COMP:N-N(by) (decrease,__SP__)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,decrease)
SUBJ:V-N (increase,contain)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 164
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           +------------------------------------------------------------------COMP:N-N(by)-----------------------------------------------------------------+       |             
           +--------------------------------------------------------------OBJ:V-N--------------------------------------------------------------+           |       |             
           |        +---------------------------------------------------------SUBJ:V-N---------------------------------------------------------+           |       |             
           |        +------------------------------------------------------SUBJ:V-N------------------------------------------------------+     |           |       |             
           +---------------------------OBJ:V-N---------------------------+-----------------------OBJ:V-N----------------------+          |     |           |       |             
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |          |     |           |       |             
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+          |     |           |       |             
   +MOD_ATT+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+          |     |           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(by) (decrease,__SP__)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,decrease)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,bind)
OBJ:V-N (increase,decrease)
SUBJ:V-N (increase,bind)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 165
                                                                         +-----------------------OBJ:V-N----------------------+                                                  
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+---------------SUBJ:V_PASS-N--------------+-----COMP:V_PASS-N(by)-----+     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+--SUBJ:V_PASS-N-+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V_PASS-N (increase,site)
SUBJ:V_PASS-N (increase,protein)
COMP:V_PASS-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 166
                                                                         +-------------------------------------------COMP:V-N(by)------------------------------------------+     
                                                                         +-----------------------OBJ:V-N----------------------+                                            |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+---------------SUBJ:V_PASS-N--------------+                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+--SUBJ:V_PASS-N-+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
COMP:V-N(by) (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
SUBJ:V_PASS-N (increase,site)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 167
                                                                         +-------------------------------------------COMP:V-N(by)------------------------------------------+     
                                                                         +-----------------------OBJ:V-N----------------------+                                            |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+---------------SUBJ:V_PASS-N--------------+                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+--SUBJ:V_PASS-N-+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
COMP:V-N(by) (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
SUBJ:V_PASS-N (increase,site)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 168
           +--------------------------------------------------------------------------COMP:V-N(by)-------------------------------------------------------------------------+     
           |                                                             +-----------------------OBJ:V-N----------------------+                                            |     
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+---------------SUBJ:V_PASS-N--------------+                           |     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+--SUBJ:V_PASS-N-+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:V-N(by) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
SUBJ:V_PASS-N (increase,site)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 169
                    +---------------------------------------------------------------------COMP:N-N(by)---------------------------------------------------------------------+     
                    |                                                    +-------------------OBJ:V-N------------------+                                                    |     
                    |                                                    |                          +------------------OBJ:V-N-----------------+                           |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 +---------OBJ:V-N--------+                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |       +----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
COMP:N-N(by) (bind,protein)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,site)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 170
                    +---------------------------------------------------------------------COMP:N-N(by)---------------------------------------------------------------------+     
                    |                                                    +---------------OBJ:V-N--------------+                                                            |     
                    |                                                    +----------OBJ:V-N---------+------------------OBJ:V-N-----------------+                           |     
                    +----------------------SUBJ:V-N----------------------+           +------MOD_ATT:N-ADJ-----+-------------OBJ:V-N------------+                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |               +----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
COMP:N-N(by) (bind,protein)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__SP__,__NODE__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,site)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 171
                    +---------------------------------------------------------SUBJ:V-N---------------------------------------------------------+                                 
                    |                                                    +-----------------------OBJ:V-N----------------------+                |                                 
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                |                                 
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                +----------OBJ:V-N----------+     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+                +COMP:V-N(by+       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (increase,bind)
COMP:V-N(by) (increase,__SP__)
OBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 172
                    +---------------------------------------------------------------------COMP:N-N(by)---------------------------------------------------------------------+     
                    +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+                           |     
                    |                                                    +-------------------------------SUBJ:V-N------------------------------+                           |     
                    |                                                    +-----------------------OBJ:V-N----------------------+                |                           |     
                    |                                                    +----------OBJ:V-N---------+                         |                |                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
COMP:N-N(by) (bind,protein)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,bind)
SUBJ:V-N (increase,contain)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 173
                    +-------------------------------------------------------SUBJ:V_PASS-N------------------------------------------------------+                                 
                    |                                                    +-----------------------OBJ:V-N----------------------+                |                                 
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                +-----COMP:V_PASS-N(by)-----+     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+                |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V_PASS-N (increase,bind)
COMP:V_PASS-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 174
                    +---------------------------------------------------------SUBJ:V-N---------------------------------------------------------+                                 
                    |                                                    +-----------------------OBJ:V-N----------------------+                |                                 
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                +--------COMP:V-N(by)-------+     
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           +-MOD_ATT:N-ADJ-+     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+                |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (increase,bind)
COMP:V-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 175
           +--------------------------------------------------------------------------COMP:V-N(by)-------------------------------------------------------------------------+     
           |        +-------------------------------------------------------SUBJ:V_PASS-N------------------------------------------------------+                           |     
           |        +------------------------------------------------------SUBJ:V-N------------------------------------------------------+     |                           |     
           |        |                                                    +-----------------------OBJ:V-N----------------------+          |     |                           |     
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |          |     |                           |     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+          |     |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+          |     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:V-N(by) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,bind)
SUBJ:V_PASS-N (increase,bind)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 176
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           +------------------------------------------------------------------COMP:N-N(by)-----------------------------------------------------------------+       |             
           +--------------------------------------------------------------OBJ:V-N--------------------------------------------------------------+           |       |             
           |                                                             +-------------------------------SUBJ:V-N------------------------------+           |       |             
           |                                                             +-----------------------OBJ:V-N----------------------+                |           |       |             
           |                                                             +----------OBJ:V-N---------+                         |                |           |       |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           |       |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+                |           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
COMP:N-N(by) (decrease,__SP__)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,decrease)
SUBJ:V-N (increase,contain)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 177
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           +------------------------------------------------------------------COMP:N-N(by)-----------------------------------------------------------------+       |             
           +--------------------------------------------------------------OBJ:V-N--------------------------------------------------------------+           |       |             
           |        +---------------------------------------------------------SUBJ:V-N---------------------------------------------------------+           |       |             
           +---------------------------OBJ:V-N---------------------------+-----------------------OBJ:V-N----------------------+                |           |       |             
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                |           |       |             
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           |       |             
   +MOD_ATT+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+                |           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(by) (decrease,__SP__)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,decrease)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,decrease)
SUBJ:V-N (increase,bind)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 178
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           +------------------------------------------------------------------COMP:N-N(by)-----------------------------------------------------------------+       |             
           +--------------------------------------------------------------OBJ:V-N--------------------------------------------------------------+           |       |             
           |                                                             +---------------OBJ:V-N--------------+                                |           |       |             
           |                                                             +----------OBJ:V-N---------+         |                                |           |       |             
           +---------------------------SUBJ:V-N--------------------------+           +------MOD_ATT:N-ADJ-----+                                |           |       |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         |               +----SUBJ:V-N----+           |       |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
COMP:N-N(by) (decrease,__SP__)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__SP__,__NODE__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,decrease)
SUBJ:V-N (increase,protein)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 179
                                                                         +-------------------------------------------COMP:V-N(by)------------------------------------------+     
                                                                         +-----------------------OBJ:V-N----------------------+                                            |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                                            |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                            +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+--SUBJ:V_PASS-N-+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
COMP:V-N(by) (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 180
                                                                         +-------------------------------------------COMP:V-N(by)------------------------------------------+     
                                                                         +-----------------------OBJ:V-N----------------------+                                            |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+---------------SUBJ:V_PASS-N--------------+                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+--SUBJ:V_PASS-N-+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
COMP:V-N(by) (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
SUBJ:V_PASS-N (increase,site)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 181
                    +-------------------------------------------------------SUBJ:V_PASS-N------------------------------------------------------+                                 
                    |                                                    +-----------------------OBJ:V-N----------------------+                |                                 
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                +-----COMP:V_PASS-N(by)-----+     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
SUBJ:V_PASS-N (increase,bind)
COMP:V_PASS-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 182
                    +---------------------------------------------------------SUBJ:V-N---------------------------------------------------------+                                 
                    |                                                    +-----------------------OBJ:V-N----------------------+                |                                 
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                +--------COMP:V-N(by)-------+     
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           +-MOD_ATT:N-ADJ-+     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
SUBJ:V-N (increase,bind)
COMP:V-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 183
                    +---------------------------------------------------------SUBJ:V-N---------------------------------------------------------+                                 
                    |                                                    +-----------------------OBJ:V-N----------------------+                |                                 
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                +----------OBJ:V-N----------+     
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                +----COMP:V-N(by)---+       |     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           +MOD_ATT+       |     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
SUBJ:V-N (increase,bind)
COMP:V-N(by) (increase,__NODE__)
OBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (__NODE__,__SP__)

Analyse 184
                    +---------------------------------------------------------------------COMP:N-N(by)---------------------------------------------------------------------+     
                    |                                                                               +------------------OBJ:V-N-----------------+                           |     
                    |                                                    +---------------OBJ:V-N--------------+                                |                           |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         +-------------OBJ:V-N------------+                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |               +----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
COMP:N-N(by) (bind,protein)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,site)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 185
                    +---------------------------------------------------------------------COMP:N-N(by)---------------------------------------------------------------------+     
                    |                                                    +-------------------OBJ:V-N------------------+                                                    |     
                    |                                                    |                          +------------------OBJ:V-N-----------------+                           |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 +---------OBJ:V-N--------+                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |       +----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
COMP:N-N(by) (bind,protein)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,site)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 186
           +--------------------------------------------------------------------------COMP:V-N(by)-------------------------------------------------------------------------+     
           |                                                             +-----------------------OBJ:V-N----------------------+                                            |     
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+---------------SUBJ:V_PASS-N--------------+                           |     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+--SUBJ:V_PASS-N-+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:V-N(by) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
SUBJ:V_PASS-N (increase,site)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 187
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           |                                                                                        +---------------------COMP:N-N(by)---------------------+       |             
           |                                                             +-------------------OBJ:V-N------------------+                                    |       |             
           |                                                             |                          +------------------OBJ:V-N-----------------+           |       |             
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 +------------COMP:N-N(by)------------+       |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 +---------OBJ:V-N--------+           |       |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +----SUBJ:V-N----+           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:N-N(by) (site,__SP__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(by) (__NODE__,__SP__)
OBJ:V-N (increase,site)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 188
                    +---------------------------------------------------------------------COMP:N-N(by)---------------------------------------------------------------------+     
                    +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+                           |     
                    |                                                    +-------------------OBJ:V-N------------------+                        |                           |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |                        |                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |       +----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
COMP:N-N(by) (bind,protein)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,bind)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 189
                                                                                                    +-----------------------------COMP:N-N(by)-----------------------------+     
                                                                         +---------------OBJ:V-N--------------+                                                            |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         +------------------------COMP:N-N(by)------------------------+     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-------------OBJ:V-N------------+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+----SUBJ:V-N----+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:N-N(by) (site,protein)
COMP:N-N(by) (__SP__,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 190
                                                                         +-------------------------------------------COMP:V-N(by)------------------------------------------+     
                                                                         +-----------------------OBJ:V-N----------------------+                                            |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                                            |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                            +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+--SUBJ:V_PASS-N-+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
COMP:V-N(by) (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 191
                                                                         +-------------------------------------------COMP:V-N(by)------------------------------------------+     
                                                                         +-----------------------OBJ:V-N----------------------+                                            |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                                            |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                            +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+--SUBJ:V_PASS-N-+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
COMP:V-N(by) (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 192
           +--------------------------------------------------------------------------COMP:V-N(by)-------------------------------------------------------------------------+     
           |                                                             +-----------------------OBJ:V-N----------------------+                                            |     
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                                            |     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                            +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+--SUBJ:V_PASS-N-+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:V-N(by) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 193
                    +---------------------------------------------------------------------COMP:N-N(by)---------------------------------------------------------------------+     
                    |                                                    +---------------OBJ:V-N--------------+                                                            |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         |                                                            |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-------------OBJ:V-N------------+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+----SUBJ:V-N----+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
COMP:N-N(by) (bind,protein)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 194
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           |                                                                                        +---------------------COMP:N-N(by)---------------------+       |             
           |                                                             +---------------OBJ:V-N--------------+----------------COMP:N-N(by)----------------+       |             
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+         +-------------OBJ:V-N------------+           |       |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         |               +----SUBJ:V-N----+           |       |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:N-N(by) (site,__SP__)
COMP:N-N(by) (__SP__,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 195
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           |                                                             +-------------------OBJ:V-N------------------+                                            |             
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 +------------COMP:N-N(by)------------+       |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 +---------OBJ:V-N--------+           |       |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +----SUBJ:V-N----+           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(by) (__NODE__,__SP__)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 196
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           |                                                             +-------------------OBJ:V-N------------------+                                            |             
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 +------------COMP:N-N(by)------------+       |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 +---------OBJ:V-N--------+           |       |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +----SUBJ:V-N----+           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(by) (__NODE__,__SP__)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 197
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                                                                            
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+----SUBJ:V-N----+----------OBJ:V-N----------+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     +COMP:V-N(by+       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
SUBJ:V-N (increase,protein)
COMP:V-N(by) (increase,__SP__)
OBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 198
                                                                         +-------------------OBJ:V-N------------------+--------------------COMP:N-N(by)--------------------+     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 +---------OBJ:V-N--------+                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |       +----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(by) (__NODE__,protein)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 199
                    +-------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------+             
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                                                              |             
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+--------------SUBJ:V-N--------------+             
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+--SUBJ:V_PASS-N-+COMP:V_PASS+       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V_PASS-N (increase,protein)
COMP:V_PASS-N(by) (increase,__SP__)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,protein)
OBJ:V-N (__NODE__,protein)

Analyse 200
           +--------------------------------------------------------------------------COMP:V-N(by)-------------------------------------------------------------------------+     
           +------------------------------------------------------OBJ:V-N-----------------------------------------------------+                                            |     
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                                            |     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                            +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+--SUBJ:V_PASS-N-+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
OBJ:V-N (decrease,protein)
COMP:V-N(by) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 201
                    +---------------------------------------------------------SUBJ:V-N---------------------------------------------------------+                                 
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                                          +--------COMP:V-N(by)-------+     
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
SUBJ:V-N (increase,bind)
SUBJ:V-N (increase,protein)
COMP:V-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 202
                                                                                                    +-----------------------------COMP:N-N(by)-----------------------------+     
                                                                         +-----------------------OBJ:V-N----------------------+----------------COMP:N-N(by)----------------+     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+---------------SUBJ:V_PASS-N--------------+                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+--SUBJ:V_PASS-N-+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:N-N(by) (site,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:N-N(by) (protein,protein)
SUBJ:V_PASS-N (increase,site)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 203
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                                          +--------COMP:V-N(by)-------+     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+----SUBJ:V-N----+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (increase,protein)
COMP:V-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 204
                                                                                                    +-----------------------------COMP:N-N(by)-----------------------------+     
                                                                         +-----------------------OBJ:V-N----------------------+----------------COMP:N-N(by)----------------+     
                                                                         |                          +---------------SUBJ:V_PASS-N--------------+                           |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+--------------SUBJ:V-N--------------+     |                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+--SUBJ:V_PASS-N-+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:N-N(by) (site,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:N-N(by) (protein,protein)
SUBJ:V-N (be,site)
SUBJ:V-N (be,protein)
SUBJ:V_PASS-N (increase,site)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 205
                    +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+                                 
                    |                                                    +-------------------------------SUBJ:V-N------------------------------+                                 
                    |                                                    +-----------------------OBJ:V-N----------------------+                |                                 
                    |                                                    +----------OBJ:V-N---------+--------------SUBJ:V-N--------------+     +--------COMP:V-N(by)-------+     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+          |     |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,site)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,bind)
SUBJ:V-N (increase,contain)
COMP:V-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 206
                    +---------------------------------------------------------------------COMP:N-N(by)---------------------------------------------------------------------+     
                    +-------------------------------------------------------SUBJ:V_PASS-N------------------------------------------------------+                           |     
                    |                                                    +-----------------------OBJ:V-N----------------------+                |                           |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                |                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+                |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
COMP:N-N(by) (bind,protein)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V_PASS-N (increase,bind)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 207
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           +------------------------------------------------------------------COMP:N-N(by)-----------------------------------------------------------------+       |             
           |                                                             +-----------------------OBJ:V-N----------------------+                            |       |             
           |                                                             |                          +---------------SUBJ:V_PASS-N--------------+           |       |             
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+--------------SUBJ:V-N--------------+     |           |       |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+--SUBJ:V_PASS-N-+           |       |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
COMP:N-N(by) (decrease,__SP__)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,site)
SUBJ:V-N (be,protein)
SUBJ:V_PASS-N (increase,site)
SUBJ:V_PASS-N (increase,protein)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 208
           +--------------------------------------------------------------------------COMP:V-N(by)-------------------------------------------------------------------------+     
           |                                                             +---------------OBJ:V-N--------------+                                                            |     
           |                                                             +----------OBJ:V-N---------+------------------OBJ:V-N-----------------+                           |     
           |        +----------------------SUBJ:V-N----------------------+           +------MOD_ATT:N-ADJ-----+-------------OBJ:V-N------------+                           |     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |               +----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:V-N(by) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__SP__,__NODE__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,site)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 209
                    +---------------------------------------------------------------------COMP:N-N(by)---------------------------------------------------------------------+     
                    +-------------------------------------------------------SUBJ:V_PASS-N------------------------------------------------------+                           |     
                    |                                                    +-----------------------OBJ:V-N----------------------+                |                           |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                |                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
COMP:N-N(by) (bind,protein)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
SUBJ:V_PASS-N (increase,bind)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 210
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           |                                                                                        +---------------------COMP:N-N(by)---------------------+       |             
           |                                                             +-----------------------OBJ:V-N----------------------+                            |       |             
           |                                                             |                          +---------------SUBJ:V_PASS-N--------------+           |       |             
           |                                                             |                          +--------------SUBJ:V-N--------------+     |           |       |             
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                         +--------COMP:N-N(by)--------+       |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+--SUBJ:V_PASS-N-+           |       |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:N-N(by) (site,__SP__)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:N-N(by) (protein,__SP__)
SUBJ:V-N (be,site)
SUBJ:V-N (be,protein)
SUBJ:V_PASS-N (increase,site)
SUBJ:V_PASS-N (increase,protein)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 211
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           +--------------------------------------------------------------OBJ:V-N--------------------------------------------------------------+                   |             
           |        +---------------------------------------------------------SUBJ:V-N---------------------------------------------------------+                   |             
           +---------------------------OBJ:V-N---------------------------+-----------------------OBJ:V-N----------------------+                |                   |             
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+--------------SUBJ:V-N--------------+     |                   |             
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+          |     |                   |             
   +MOD_ATT+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     +COMP:V-N(by+       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,decrease)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,site)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,decrease)
SUBJ:V-N (increase,bind)
COMP:V-N(by) (increase,__SP__)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 212
                                                                                                    +------------------OBJ:V-N-----------------+                                 
                                                                         +---------------OBJ:V-N--------------+                                |                                 
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         +-------------OBJ:V-N------------+--------COMP:V-N(by)-------+     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |               +----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,site)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
COMP:V-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 213
                                                                                                    +-----------------------------COMP:N-N(by)-----------------------------+     
                                                                         +-----------------------OBJ:V-N----------------------+----------------COMP:N-N(by)----------------+     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+---------------SUBJ:V_PASS-N--------------+                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+--SUBJ:V_PASS-N-+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:N-N(by) (site,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:N-N(by) (protein,protein)
SUBJ:V-N (be,protein)
SUBJ:V_PASS-N (increase,site)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 214
                    +---------------------------------------------------------------------COMP:N-N(by)---------------------------------------------------------------------+     
                    |                                                    +-----------------------OBJ:V-N----------------------+                                            |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                                            |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                            +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+--SUBJ:V_PASS-N-+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
COMP:N-N(by) (bind,protein)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 215
                    +---------------------------------------------------------------------COMP:N-N(by)---------------------------------------------------------------------+     
                    |                                                    +-----------------------OBJ:V-N----------------------+                                            |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+---------------SUBJ:V_PASS-N--------------+                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+--SUBJ:V_PASS-N-+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
COMP:N-N(by) (bind,protein)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V_PASS-N (increase,site)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 216
           +--------------------------------------------------------------------------COMP:V-N(by)-------------------------------------------------------------------------+     
           |                                                             +-------------------OBJ:V-N------------------+                                                    |     
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+------------------OBJ:V-N-----------------+                           |     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 +---------OBJ:V-N--------+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +----SUBJ:V-N----+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:V-N(by) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (increase,site)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 217
           +--------------------------------------------------------------------------COMP:V-N(by)-------------------------------------------------------------------------+     
           |        +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+                           |     
           |        |                                                    +---------------OBJ:V-N--------------+                                |                           |     
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         |                                |                           |     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |                                |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+----SUBJ:V-N----+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:V-N(by) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,bind)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 218
           +--------------------------------------------------------------------------COMP:V-N(by)-------------------------------------------------------------------------+     
           |        +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+                           |     
           |        |                                                    +-------------------OBJ:V-N------------------+                        |                           |     
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |                        |                           |     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |       +----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:V-N(by) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,bind)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 219
                                                                         +-------------------------------------------COMP:V-N(by)------------------------------------------+     
                                                                         |                          +------------------OBJ:V-N-----------------+                           |     
                                                                         +---------------OBJ:V-N--------------+                                |                           |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         +-------------OBJ:V-N------------+                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |               +----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
COMP:V-N(by) (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,site)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 220
                    +---------------------------------------------------------------------COMP:N-N(by)---------------------------------------------------------------------+     
                    |                                                    +-----------------------OBJ:V-N----------------------+                                            |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                                            |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+--SUBJ:V_PASS-N-+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
COMP:N-N(by) (bind,protein)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 221
           +----------------------------------------------OBJ:V-N---------------------------------------------+                                                                  
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         +-------------OBJ:V-N------------+--------COMP:V-N(by)-------+     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |               +----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
OBJ:V-N (decrease,__SP__)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
COMP:V-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 222
           +--------------------------------------------------------------------------COMP:V-N(by)-------------------------------------------------------------------------+     
           |        +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+                           |     
           |        |                                                    +---------------OBJ:V-N--------------+                                |                           |     
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         |                                |                           |     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |               +----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:V-N(by) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,bind)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 223
                                                                         +-----------------------OBJ:V-N----------------------+                                                  
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         +----------------COMP:N-N(by)----------------+     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                            +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+--SUBJ:V_PASS-N-+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:N-N(by) (protein,protein)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 224
                    +-------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------+             
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         +--------------SUBJ:V-N--------------+             
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+--------COMP:N-N(by)--------+       |             
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+--SUBJ:V_PASS-N-+           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:N-N(by) (protein,__SP__)
SUBJ:V_PASS-N (increase,protein)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,protein)
OBJ:V-N (__NODE__,protein)

Analyse 225
                    +---------------------------------------------------------------SUBJ:V-N---------------------------------------------------------------+                     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 +--------------SUBJ:V-N--------------+                     
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 +---------OBJ:V-N--------+           +----OBJ:V-N----+     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +----SUBJ:V-N----+MOD:V-+    |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |      |    |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
MOD:V-ADV (increase,by)
SUBJ:V-N (__SP__,bind)
SUBJ:V-N (__SP__,__NODE__)
OBJ:V-N (__SP__,protein)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 226
                    +---------------------------------------------------------------SUBJ:V-N---------------------------------------------------------------+                     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         +------------------SUBJ:V-N------------------+                     
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-------------OBJ:V-N------------+           +----OBJ:V-N----+     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+----SUBJ:V-N----+MOD:V-+    |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |      |    |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
MOD:V-ADV (increase,by)
SUBJ:V-N (__SP__,bind)
SUBJ:V-N (__SP__,__SP__)
OBJ:V-N (__SP__,protein)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 227
                    +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+                                 
           +--------------------------------------------------OBJ:V-N-------------------------------------------------+                        |                                 
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 +---------OBJ:V-N--------+--------COMP:V-N(by)-------+     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |       +----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
OBJ:V-N (decrease,__NODE__)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,bind)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
COMP:V-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 228
           +--------------------------------------------------------------------------COMP:V-N(by)-------------------------------------------------------------------------+     
           |        +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+                           |     
           +--------------------------------------------------OBJ:V-N-------------------------------------------------+                        |                           |     
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 +---------OBJ:V-N--------+                           |     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |       +----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
OBJ:V-N (decrease,__NODE__)
COMP:V-N(by) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,bind)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 229
                    +-------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------+             
                    +-------------------------------------------------------------COMP:N-N(by)-------------------------------------------------------------+       |             
                    +-------------------------------------------------------SUBJ:V_PASS-N------------------------------------------------------+           |       |             
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         +--------------SUBJ:V-N--------------+             
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+--------COMP:N-N(by)--------+       |             
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+--SUBJ:V_PASS-N-+           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
COMP:N-N(by) (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:N-N(by) (protein,__SP__)
SUBJ:V_PASS-N (increase,bind)
SUBJ:V_PASS-N (increase,protein)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,protein)
OBJ:V-N (__NODE__,protein)

Analyse 230
                    +-------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------+             
                    +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+                   |             
                    |                                                                                                 +------------------SUBJ:V-N------------------+             
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 +---------OBJ:V-N--------+                   |             
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |       +----SUBJ:V-N----+                   |             
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +-SUBJ:V-N-+     +COMP:V-N(by+       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,bind)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
COMP:V-N(by) (increase,__SP__)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__NODE__)
OBJ:V-N (__NODE__,protein)

Analyse 231
                    +---------------------------------------------------------------SUBJ:V-N---------------------------------------------------------------+                     
                    +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+           |                     
                    |                                                                                                 +--------------SUBJ:V-N--------------+                     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 +---------OBJ:V-N--------+           |                     
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |       +----SUBJ:V-N----+           +----OBJ:V-N----+     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +-SUBJ:V-N-+     +MOD:V-+    |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |      |    |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,bind)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
MOD:V-ADV (increase,by)
SUBJ:V-N (__SP__,bind)
SUBJ:V-N (__SP__,__NODE__)
OBJ:V-N (__SP__,protein)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 232
                    +---------------------------------------------------------------SUBJ:V-N---------------------------------------------------------------+                     
                    +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+           |                     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 +--------------SUBJ:V-N--------------+                     
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 +---------OBJ:V-N--------+           +----OBJ:V-N----+     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +----SUBJ:V-N----+MOD:V-+    |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |      |    |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (increase,bind)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
MOD:V-ADV (increase,by)
SUBJ:V-N (__SP__,bind)
SUBJ:V-N (__SP__,__NODE__)
OBJ:V-N (__SP__,protein)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 233
                    +---------------------------------------------SUBJ:V-N--------------------------------------------+                                                          
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |       +----------------COMP:N-N(by)----------------+     
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |       |                            +-MOD_ATT:N-ADJ-+     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+--SUBJ:V_PASS-N-+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)
COMP:N-N(by) (protein,protein)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 234
                    +---------------------------------------------------------------SUBJ:V-N---------------------------------------------------------------+                     
                    +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+           |                     
                    |                                                                                         +------------------SUBJ:V-N------------------+                     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         +-------------OBJ:V-N------------+           |                     
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |               +----SUBJ:V-N----+           +----OBJ:V-N----+     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     +MOD:V-+    |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |      |    |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,bind)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
MOD:V-ADV (increase,by)
SUBJ:V-N (__SP__,bind)
SUBJ:V-N (__SP__,__SP__)
OBJ:V-N (__SP__,protein)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 235
                    +---------------------------------------------------------------SUBJ:V-N---------------------------------------------------------------+                     
                    +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+           |                     
                    |                                                                                         +------------------SUBJ:V-N------------------+                     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         +-------------OBJ:V-N------------+           |                     
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |               +----SUBJ:V-N----+           +----OBJ:V-N----+     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     +MOD:V-+    |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |      |    |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,bind)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
MOD:V-ADV (increase,by)
SUBJ:V-N (__SP__,bind)
SUBJ:V-N (__SP__,__SP__)
OBJ:V-N (__SP__,protein)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 236
                    +---------------------------------------------------------------SUBJ:V-N---------------------------------------------------------------+                     
                    +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+           |                     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         +------------------SUBJ:V-N------------------+                     
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-------------OBJ:V-N------------+           +----OBJ:V-N----+     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+----SUBJ:V-N----+MOD:V-+    |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |      |    |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,bind)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
MOD:V-ADV (increase,by)
SUBJ:V-N (__SP__,bind)
SUBJ:V-N (__SP__,__SP__)
OBJ:V-N (__SP__,protein)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 237
                                                                                                    +-----------------------------COMP:N-N(by)-----------------------------+     
                                                                         +---------------OBJ:V-N--------------+                                                            |     
                                                                         +----------OBJ:V-N---------+------------------OBJ:V-N-----------------+                           |     
                                                                         |           +------MOD_ATT:N-ADJ-----+                                |                           |     
                    +----------------------SUBJ:V-N----------------------+           |       +--MOD_ATT:N-ADJ-+------------------------COMP:N-N(by)------------------------+     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-------------OBJ:V-N------------+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+----SUBJ:V-N----+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:N-N(by) (site,protein)
MOD_ATT:N-ADJ (__SP__,__NODE__)
MOD_ATT:N-ADJ (__SP__,binding)
COMP:N-N(by) (__SP__,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,site)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 238
                                                                         +-------------------------------------------COMP:V-N(by)------------------------------------------+     
                                                                         +-----------------------OBJ:V-N----------------------+                                            |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+---------------SUBJ:V_PASS-N--------------+                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+--SUBJ:V_PASS-N-+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
COMP:V-N(by) (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V_PASS-N (increase,site)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 239
                    +---------------------------------------------------------SUBJ:V-N---------------------------------------------------------+                                 
                    |                                                    +-----------------------OBJ:V-N----------------------+                |                                 
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+--------------SUBJ:V-N--------------+     |                                 
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+          |     +----------OBJ:V-N----------+     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     +COMP:V-N(by+       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,site)
SUBJ:V-N (be,protein)
SUBJ:V-N (increase,bind)
COMP:V-N(by) (increase,__SP__)
OBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 240
           +--------------------------------------------------------------------------COMP:V-N(by)-------------------------------------------------------------------------+     
           |                                                             +-----------------------OBJ:V-N----------------------+                                            |     
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+---------------SUBJ:V_PASS-N--------------+                           |     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+--SUBJ:V_PASS-N-+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:V-N(by) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V_PASS-N (increase,site)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 241
                    +---------------------------------------------------------SUBJ:V-N---------------------------------------------------------+                                 
                    |                                                    +-----------------------OBJ:V-N----------------------+                |                                 
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                |                                 
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                +----------OBJ:V-N----------+     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+                +COMP:V-N(by+       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (increase,bind)
COMP:V-N(by) (increase,__SP__)
OBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 242
           +--------------------------------------------------------------------------COMP:V-N(by)-------------------------------------------------------------------------+     
           |        +-------------------------------------------------------SUBJ:V_PASS-N------------------------------------------------------+                           |     
           |        +------------------------------------------------------SUBJ:V-N------------------------------------------------------+     |                           |     
           |        |                                                    +-----------------------OBJ:V-N----------------------+          |     |                           |     
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |          |     |                           |     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+          |     |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+          |     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:V-N(by) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,bind)
SUBJ:V_PASS-N (increase,bind)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 243
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           +------------------------------------------------------------------COMP:N-N(by)-----------------------------------------------------------------+       |             
           +--------------------------------------------------------------OBJ:V-N--------------------------------------------------------------+           |       |             
           |        +---------------------------------------------------------SUBJ:V-N---------------------------------------------------------+           |       |             
           +---------------------------OBJ:V-N---------------------------+-----------------------OBJ:V-N----------------------+                |           |       |             
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                |           |       |             
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           |       |             
   +MOD_ATT+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+                |           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(by) (decrease,__SP__)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,decrease)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,decrease)
SUBJ:V-N (increase,bind)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 244
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           +------------------------------------------------------------------COMP:N-N(by)-----------------------------------------------------------------+       |             
           +--------------------------------------------------------------OBJ:V-N--------------------------------------------------------------+           |       |             
           |        +---------------------------------------------------------SUBJ:V-N---------------------------------------------------------+           |       |             
           +---------------------------OBJ:V-N---------------------------+-----------------------OBJ:V-N----------------------+                |           |       |             
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                |           |       |             
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           |       |             
   +MOD_ATT+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+                |           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(by) (decrease,__SP__)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,decrease)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,decrease)
SUBJ:V-N (increase,bind)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 245
                    +---------------------------------------------------------SUBJ:V-N---------------------------------------------------------+                                 
                    |                                                    +-----------------------OBJ:V-N----------------------+                |                                 
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                +--------COMP:V-N(by)-------+     
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           +-MOD_ATT:N-ADJ-+     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
SUBJ:V-N (increase,bind)
COMP:V-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 246
                                                                         +-------------------------------------------COMP:V-N(by)------------------------------------------+     
                                                                         +-----------------------OBJ:V-N----------------------+                                            |     
                                                                         |                          +---------------SUBJ:V_PASS-N--------------+                           |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+--------------SUBJ:V-N--------------+     |                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+--SUBJ:V_PASS-N-+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
COMP:V-N(by) (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,site)
SUBJ:V-N (be,protein)
SUBJ:V_PASS-N (increase,site)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 247
                    +---------------------------------------------------------SUBJ:V-N---------------------------------------------------------+                                 
                    |                                                    +-----------------------OBJ:V-N----------------------+                |                                 
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+--------------SUBJ:V-N--------------+     +----------OBJ:V-N----------+     
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+          |     +----COMP:V-N(by)---+       |     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           +MOD_ATT+       |     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,site)
SUBJ:V-N (be,protein)
SUBJ:V-N (increase,bind)
COMP:V-N(by) (increase,__NODE__)
OBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (__NODE__,__SP__)

Analyse 248
           +--------------------------------------------------------------------------COMP:V-N(by)-------------------------------------------------------------------------+     
           |                                                             +-----------------------OBJ:V-N----------------------+                                            |     
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+---------------SUBJ:V_PASS-N--------------+                           |     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+--SUBJ:V_PASS-N-+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:V-N(by) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V_PASS-N (increase,site)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 249
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           |                                                                                        +---------------------COMP:N-N(by)---------------------+       |             
           |                                                             +---------------OBJ:V-N--------------+                                            |       |             
           |                                                             +----------OBJ:V-N---------+------------------OBJ:V-N-----------------+           |       |             
           +---------------------------SUBJ:V-N--------------------------+           +------MOD_ATT:N-ADJ-----+----------------COMP:N-N(by)----------------+       |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         +-------------OBJ:V-N------------+           |       |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+----SUBJ:V-N----+           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:N-N(by) (site,__SP__)
MOD_ATT:N-ADJ (__SP__,__NODE__)
COMP:N-N(by) (__SP__,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,site)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 250
                    +-------------------------------------------------------SUBJ:V_PASS-N------------------------------------------------------+                                 
                    |                                                    +-----------------------OBJ:V-N----------------------+                |                                 
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                +-----COMP:V_PASS-N(by)-----+     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+                |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V_PASS-N (increase,bind)
COMP:V_PASS-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 251
                    +---------------------------------------------------------------------COMP:N-N(by)---------------------------------------------------------------------+     
                    +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+                           |     
                    |                                                    +-------------------------------SUBJ:V-N------------------------------+                           |     
                    |                                                    +-----------------------OBJ:V-N----------------------+                |                           |     
                    |                                                    +----------OBJ:V-N---------+                         |                |                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+                |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
COMP:N-N(by) (bind,protein)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,bind)
SUBJ:V-N (increase,contain)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 252
                    +---------------------------------------------------------------------COMP:N-N(by)---------------------------------------------------------------------+     
                    +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+                           |     
                    |                                                    +-------------------OBJ:V-N------------------+                        |                           |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |                        |                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |                        |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +----SUBJ:V-N----+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
COMP:N-N(by) (bind,protein)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (increase,bind)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 253
                    +---------------------------------------------------------------------COMP:N-N(by)---------------------------------------------------------------------+     
                    +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+                           |     
                    |                                                    +-------------------OBJ:V-N------------------+                        |                           |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |                        |                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |                        |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +----SUBJ:V-N----+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
COMP:N-N(by) (bind,protein)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (increase,bind)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 254
                    +---------------------------------------------------------SUBJ:V-N---------------------------------------------------------+                                 
                    |                                                    +-----------------------OBJ:V-N----------------------+                |                                 
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                |                                 
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                +----------OBJ:V-N----------+     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+                +COMP:V-N(by+       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (increase,bind)
COMP:V-N(by) (increase,__SP__)
OBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 255
                    +---------------------------------------------------------SUBJ:V-N---------------------------------------------------------+                                 
                    |                                                    +-----------------------OBJ:V-N----------------------+                |                                 
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                +----------OBJ:V-N----------+     
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                +----COMP:V-N(by)---+       |     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+                |           +MOD_ATT+       |     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (increase,bind)
COMP:V-N(by) (increase,__NODE__)
OBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (__NODE__,__SP__)

Analyse 256
                                                                         +-----------------------OBJ:V-N----------------------+                                                  
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+---------------SUBJ:V_PASS-N--------------+-----COMP:V_PASS-N(by)-----+     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+--SUBJ:V_PASS-N-+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
SUBJ:V_PASS-N (increase,site)
SUBJ:V_PASS-N (increase,protein)
COMP:V_PASS-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 257
                    +---------------------------------------------------------------------COMP:N-N(by)---------------------------------------------------------------------+     
                    |                                                    +-------------------OBJ:V-N------------------+                                                    |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |                                                    |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 +---------OBJ:V-N--------+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +----SUBJ:V-N----+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
COMP:N-N(by) (bind,protein)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 258
                    +---------------------------------------------------------SUBJ:V-N---------------------------------------------------------+                                 
                    |                                                    +-----------------------OBJ:V-N----------------------+                |                                 
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                |                                 
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                +----------OBJ:V-N----------+     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     +COMP:V-N(by+       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
SUBJ:V-N (increase,bind)
COMP:V-N(by) (increase,__SP__)
OBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 259
                    +---------------------------------------------------------------------COMP:N-N(by)---------------------------------------------------------------------+     
                    |                                                    +---------------OBJ:V-N--------------+                                                            |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         +-------------OBJ:V-N------------+                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |               +----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
COMP:N-N(by) (bind,protein)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 260
                    +---------------------------------------------------------SUBJ:V-N---------------------------------------------------------+                                 
                    |                                                    +-----------------------OBJ:V-N----------------------+                |                                 
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                +----------OBJ:V-N----------+     
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                +----COMP:V-N(by)---+       |     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           +MOD_ATT+       |     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
SUBJ:V-N (increase,bind)
COMP:V-N(by) (increase,__NODE__)
OBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (__NODE__,__SP__)

Analyse 261
                    +---------------------------------------------------------------------COMP:N-N(by)---------------------------------------------------------------------+     
                    |                                                    +-------------------OBJ:V-N------------------+                                                    |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+------------------OBJ:V-N-----------------+                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 +---------OBJ:V-N--------+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +----SUBJ:V-N----+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
COMP:N-N(by) (bind,protein)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (increase,site)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 262
                    +---------------------------------------------------------------------COMP:N-N(by)---------------------------------------------------------------------+     
                    +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+                           |     
                    |                                                    +-------------------------------SUBJ:V-N------------------------------+                           |     
                    |                                                    +-----------------------OBJ:V-N----------------------+                |                           |     
                    |                                                    +----------OBJ:V-N---------+                         |                |                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+                |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
COMP:N-N(by) (bind,protein)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,bind)
SUBJ:V-N (increase,contain)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 263
                    +---------------------------------------------------------------------COMP:N-N(by)---------------------------------------------------------------------+     
                    +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+                           |     
                    |                                                    +---------------OBJ:V-N--------------+                                |                           |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         |                                |                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |               +----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
COMP:N-N(by) (bind,protein)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,bind)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 264
                    +---------------------------------------------------------------------COMP:N-N(by)---------------------------------------------------------------------+     
                    +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+                           |     
                    |                                                    +---------------OBJ:V-N--------------+                                |                           |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         |                                |                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |                                |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+----SUBJ:V-N----+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
COMP:N-N(by) (bind,protein)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,bind)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 265
                    +---------------------------------------------------------------------COMP:N-N(by)---------------------------------------------------------------------+     
                    +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+                           |     
                    |                                                    +---------------OBJ:V-N--------------+                                |                           |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         |                                |                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |                                |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+----SUBJ:V-N----+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
COMP:N-N(by) (bind,protein)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,bind)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 266
           +------------------------------------------------------OBJ:V-N-----------------------------------------------------+                                                  
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                +-----COMP:V_PASS-N(by)-----+     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+--SUBJ:V_PASS-N-+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
OBJ:V-N (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V_PASS-N (increase,protein)
COMP:V_PASS-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 267
           +--------------------------------------------------OBJ:V-N-------------------------------------------------+--------------------COMP:N-N(by)--------------------+     
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 +---------OBJ:V-N--------+                           |     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |       +----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
OBJ:V-N (decrease,__NODE__)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(by) (__NODE__,protein)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 268
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           |                                                                                        +---------------------COMP:N-N(by)---------------------+       |             
           |                                                             +---------------OBJ:V-N--------------+----------------COMP:N-N(by)----------------+       |             
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+------------------OBJ:V-N-----------------+           |       |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         +-------------OBJ:V-N------------+           |       |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+----SUBJ:V-N----+           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:N-N(by) (site,__SP__)
COMP:N-N(by) (__SP__,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,site)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 269
                    +---------------------------------------------------------------------COMP:N-N(by)---------------------------------------------------------------------+     
                    +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+                           |     
                    |                                                    +---------------OBJ:V-N--------------+                                |                           |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         |                                |                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |               +----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
COMP:N-N(by) (bind,protein)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,bind)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 270
                                                                                                    +-----------------------------COMP:N-N(by)-----------------------------+     
                                                                         +---------------OBJ:V-N--------------+                                                            |     
                                                                         +----------OBJ:V-N---------+         +------------------------COMP:N-N(by)------------------------+     
                    +----------------------SUBJ:V-N----------------------+           +------MOD_ATT:N-ADJ-----+-------------OBJ:V-N------------+                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |               +----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:N-N(by) (site,protein)
MOD_ATT:N-ADJ (__SP__,__NODE__)
COMP:N-N(by) (__SP__,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 271
                                                                         +-------------------OBJ:V-N------------------+--------------------COMP:N-N(by)--------------------+     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 +---------OBJ:V-N--------+                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |       +----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(by) (__NODE__,protein)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 272
                                                                         +-------------------OBJ:V-N------------------+--------------------COMP:N-N(by)--------------------+     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 +---------OBJ:V-N--------+                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |       +----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(by) (__NODE__,protein)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 273
                    +-------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------+             
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         +--------------SUBJ:V-N--------------+             
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+--SUBJ:V_PASS-N-+                   |             
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     +COMP:V_PASS+       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
SUBJ:V_PASS-N (increase,protein)
COMP:V_PASS-N(by) (increase,__SP__)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,protein)
OBJ:V-N (__NODE__,protein)

Analyse 274
                    +-------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------+             
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         +--------------SUBJ:V-N--------------+             
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+--SUBJ:V_PASS-N-+                   |             
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     +COMP:V_PASS+       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
SUBJ:V_PASS-N (increase,protein)
COMP:V_PASS-N(by) (increase,__SP__)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,protein)
OBJ:V-N (__NODE__,protein)

Analyse 275
                    +-------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------+             
                    |                                                                                         +----------------------SUBJ:V-N----------------------+             
                    |                                                                                         +----------------COMP:N-N(by)----------------+       |             
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         +-------------OBJ:V-N------------+           |       |             
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |               +----SUBJ:V-N----+           |       |             
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:N-N(by) (__SP__,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 276
                    +---------------------------------------------------------SUBJ:V-N---------------------------------------------------------+                                 
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                                          |                                 
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+----SUBJ:V-N----+----------OBJ:V-N----------+     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     +COMP:V-N(by+       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
SUBJ:V-N (increase,bind)
SUBJ:V-N (increase,protein)
COMP:V-N(by) (increase,__SP__)
OBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 277
           +--------------------------------------------------------------------------COMP:V-N(by)-------------------------------------------------------------------------+     
           |        +-------------------------------------------------------SUBJ:V_PASS-N------------------------------------------------------+                           |     
           |        +------------------------------------------------------SUBJ:V-N------------------------------------------------------+     |                           |     
           +------------------------------------------------------OBJ:V-N-----------------------------------------------------+          |     |                           |     
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |          |     |                           |     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+--SUBJ:V_PASS-N-+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
OBJ:V-N (decrease,protein)
COMP:V-N(by) (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,bind)
SUBJ:V-N (be,protein)
SUBJ:V_PASS-N (increase,bind)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 278
                    +---------------------------------------------------------SUBJ:V-N---------------------------------------------------------+                                 
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                                          +----------OBJ:V-N----------+     
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                +----COMP:V-N(by)---+       |     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+----SUBJ:V-N----+           +MOD_ATT+       |     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (increase,bind)
SUBJ:V-N (increase,protein)
COMP:V-N(by) (increase,__NODE__)
OBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (__NODE__,__SP__)

Analyse 279
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           +------------------------------------------------------------------COMP:N-N(by)-----------------------------------------------------------------+       |             
           +--------------------------------------------------------------OBJ:V-N--------------------------------------------------------------+           |       |             
           |                                                                                                          +------------------SUBJ:V-N------------------+             
           |                                                                                                          +------------COMP:N-N(by)------------+       |             
           +---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 +---------OBJ:V-N--------+           |       |             
           +-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |       +----SUBJ:V-N----+           |       |             
   +MOD_ATT+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +-SUBJ:V-N-+     |           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(of) (decrease,fragment)
COMP:N-N(by) (decrease,__SP__)
SUBJ:V-N (bind,decrease)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,decrease)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(by) (__NODE__,__SP__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,decrease)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (__NODE__,decrease)
SUBJ:V-N (__NODE__,__NODE__)
OBJ:V-N (__NODE__,protein)

Analyse 280
                    +---------------------------------------------SUBJ:V-N--------------------------------------------+                                                          
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |                        +-----COMP:V_PASS-N(by)-----+     
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |                        |           +-MOD_ATT:N-ADJ-+     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+--SUBJ:V_PASS-N-+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)
SUBJ:V_PASS-N (increase,protein)
COMP:V_PASS-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 281
                    +---------------------------------------------SUBJ:V-N--------------------------------------------+                                                          
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 +--------------------COMP:V-N(by)--------------------+     
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |       +--SUBJ:V_PASS-N-+           +-MOD_ATT:N-ADJ-+     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)
COMP:V-N(by) (__NODE__,protein)
SUBJ:V-N (be,protein)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 282
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                                          +----------OBJ:V-N----------+     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+----SUBJ:V-N----+----COMP:V-N(by)---+       |     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           +MOD_ATT+       |     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
SUBJ:V-N (increase,protein)
COMP:V-N(by) (increase,__NODE__)
OBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (__NODE__,__SP__)

Analyse 283
                    +---------------------------------------------------------------------COMP:N-N(by)---------------------------------------------------------------------+     
                    |                                                    +-----------------------OBJ:V-N----------------------+                                            |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+---------------SUBJ:V_PASS-N--------------+                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+--SUBJ:V_PASS-N-+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
COMP:N-N(by) (bind,protein)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V_PASS-N (increase,site)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 284
                    +---------------------------------------------------------------------COMP:N-N(by)---------------------------------------------------------------------+     
                    +-------------------------------------------------------SUBJ:V_PASS-N------------------------------------------------------+                           |     
                    |                                                    +-----------------------OBJ:V-N----------------------+                |                           |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                |                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+                |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
COMP:N-N(by) (bind,protein)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V_PASS-N (increase,bind)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 285
           +------------------------------------------------------OBJ:V-N-----------------------------------------------------+                                                  
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         +----------------COMP:N-N(by)----------------+     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                            +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+--SUBJ:V_PASS-N-+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
OBJ:V-N (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:N-N(by) (protein,protein)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 286
                    +-------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------+             
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         +--------------SUBJ:V-N--------------+             
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+--------COMP:N-N(by)--------+       |             
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+--SUBJ:V_PASS-N-+           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:N-N(by) (protein,__SP__)
SUBJ:V_PASS-N (increase,protein)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,protein)
OBJ:V-N (__NODE__,protein)

Analyse 287
                    +-------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------+             
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         +--------------SUBJ:V-N--------------+             
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+--------COMP:N-N(by)--------+       |             
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+--SUBJ:V_PASS-N-+           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:N-N(by) (protein,__SP__)
SUBJ:V_PASS-N (increase,protein)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,protein)
OBJ:V-N (__NODE__,protein)

Analyse 288
                    +---------------------------------------------------------------SUBJ:V-N---------------------------------------------------------------+                     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 +--------------SUBJ:V-N--------------+                     
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 +---------OBJ:V-N--------+           +----OBJ:V-N----+     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +----SUBJ:V-N----+MOD:V-+    |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |      |    |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
MOD:V-ADV (increase,by)
SUBJ:V-N (__SP__,bind)
SUBJ:V-N (__SP__,__NODE__)
OBJ:V-N (__SP__,protein)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 289
                    +---------------------------------------------------------------SUBJ:V-N---------------------------------------------------------------+                     
                    |                                                                                         +------------------SUBJ:V-N------------------+                     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         +-------------OBJ:V-N------------+           |                     
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |               +----SUBJ:V-N----+           +----OBJ:V-N----+     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     +MOD:V-+    |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |      |    |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
MOD:V-ADV (increase,by)
SUBJ:V-N (__SP__,bind)
SUBJ:V-N (__SP__,__SP__)
OBJ:V-N (__SP__,protein)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 290
                    +---------------------------------------------------------------SUBJ:V-N---------------------------------------------------------------+                     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         +------------------SUBJ:V-N------------------+                     
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-------------OBJ:V-N------------+           +----OBJ:V-N----+     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+----SUBJ:V-N----+MOD:V-+    |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |      |    |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
MOD:V-ADV (increase,by)
SUBJ:V-N (__SP__,bind)
SUBJ:V-N (__SP__,__SP__)
OBJ:V-N (__SP__,protein)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 291
                    +-------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------+             
                    +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+                   |             
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 +------------------SUBJ:V-N------------------+             
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 +---------OBJ:V-N--------+                   |             
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +----SUBJ:V-N----+COMP:V-N(by+       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (increase,bind)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
COMP:V-N(by) (increase,__SP__)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__NODE__)
OBJ:V-N (__NODE__,protein)

Analyse 292
                    +-------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------+             
                    +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+                   |             
                    |                                                                                                 +------------------SUBJ:V-N------------------+             
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 +---------OBJ:V-N--------+                   |             
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |       +----SUBJ:V-N----+                   |             
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +-SUBJ:V-N-+     +COMP:V-N(by+       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,bind)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
COMP:V-N(by) (increase,__SP__)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__NODE__)
OBJ:V-N (__NODE__,protein)

Analyse 293
                                                                         +-----------------------OBJ:V-N----------------------+                                                  
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+---------------SUBJ:V_PASS-N--------------+-----COMP:V_PASS-N(by)-----+     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+--SUBJ:V_PASS-N-+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V_PASS-N (increase,site)
SUBJ:V_PASS-N (increase,protein)
COMP:V_PASS-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 294
                                                                         +-------------------------------------------COMP:V-N(by)------------------------------------------+     
                                                                         +-----------------------OBJ:V-N----------------------+                                            |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+---------------SUBJ:V_PASS-N--------------+                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                |           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+--SUBJ:V_PASS-N-+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
COMP:V-N(by) (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V_PASS-N (increase,site)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 295
                    +---------------------------------------------------------SUBJ:V-N---------------------------------------------------------+                                 
                    |                                                    +-----------------------OBJ:V-N----------------------+                |                                 
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                |                                 
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                +----------OBJ:V-N----------+     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+                +COMP:V-N(by+       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (increase,bind)
COMP:V-N(by) (increase,__SP__)
OBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 296
                                                                                                    +-----------------------------COMP:N-N(by)-----------------------------+     
                                                                         +-------------------OBJ:V-N------------------+--------------------COMP:N-N(by)--------------------+     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+------------------OBJ:V-N-----------------+                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 +---------OBJ:V-N--------+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +----SUBJ:V-N----+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:N-N(by) (site,protein)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(by) (__NODE__,protein)
OBJ:V-N (increase,site)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 297
                    +---------------------------------------------------------SUBJ:V-N---------------------------------------------------------+                                 
                    |                                                    +-----------------------OBJ:V-N----------------------+                |                                 
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |                +----------OBJ:V-N----------+     
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+                +----COMP:V-N(by)---+       |     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+                |           +MOD_ATT+       |     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (increase,bind)
COMP:V-N(by) (increase,__NODE__)
OBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (__NODE__,__SP__)

Analyse 298
           +------------------------------------------------------------------------SUBJ:V-N-----------------------------------------------------------------------+             
           +------------------------------------------------------------------COMP:N-N(by)-----------------------------------------------------------------+       |             
           +--------------------------------------------------------------OBJ:V-N--------------------------------------------------------------+           |       |             
           |        +---------------------------------------------------------SUBJ:V-N---------------------------------------------------------+           |       |             
           +---------------------------OBJ:V-N---------------------------+-----------------------OBJ:V-N----------------------+                |           |       |             
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+--------------SUBJ:V-N--------------+     |           |       |             
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+          |     |           |       |             
   +MOD_ATT+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (decrease,U0126)
COMP:N-N(by) (decrease,__SP__)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,decrease)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,site)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,decrease)
SUBJ:V-N (increase,bind)
SUBJ:V-N (__NODE__,decrease)
OBJ:V-N (__NODE__,protein)

Analyse 299
                                                                                                    +-----------------------------COMP:N-N(by)-----------------------------+     
                                                                         +-------------------OBJ:V-N------------------+--------------------COMP:N-N(by)--------------------+     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 +---------OBJ:V-N--------+                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |       +----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:N-N(by) (site,protein)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(by) (__NODE__,protein)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 300
                                                                                                    +-----------------------------COMP:N-N(by)-----------------------------+     
                                                                         +---------------OBJ:V-N--------------+                                                            |     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         +------------------------COMP:N-N(by)------------------------+     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-------------OBJ:V-N------------+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+----SUBJ:V-N----+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:N-N(by) (site,protein)
COMP:N-N(by) (__SP__,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 301
                                                                         +-------------------OBJ:V-N------------------+--------------------COMP:N-N(by)--------------------+     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 +---------OBJ:V-N--------+                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |       +----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(by) (__NODE__,protein)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 302
                    +-------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------+             
                    |                                                                                                 +------------------SUBJ:V-N------------------+             
                    |                                                                                                 +------------COMP:N-N(by)------------+       |             
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 +---------OBJ:V-N--------+           |       |             
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |       +----SUBJ:V-N----+           |       |             
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +-SUBJ:V-N-+     |           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(by) (__NODE__,__SP__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__NODE__)
OBJ:V-N (__NODE__,protein)

Analyse 303
                    +-------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------+             
                    |                                                                                                 +------------------SUBJ:V-N------------------+             
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 +------------COMP:N-N(by)------------+       |             
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 +---------OBJ:V-N--------+           |       |             
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +----SUBJ:V-N----+           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(by) (__NODE__,__SP__)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__NODE__)
OBJ:V-N (__NODE__,protein)

Analyse 304
                    +---------------------------------------------------------SUBJ:V-N---------------------------------------------------------+                                 
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                                          +----------OBJ:V-N----------+     
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+----SUBJ:V-N----+----COMP:V-N(by)---+       |     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           +MOD_ATT+       |     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
SUBJ:V-N (increase,bind)
SUBJ:V-N (increase,protein)
COMP:V-N(by) (increase,__NODE__)
OBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (__NODE__,__SP__)

Analyse 305
                    +-------------------------------------------------------SUBJ:V_PASS-N------------------------------------------------------+                                 
                    +------------------------------------------------------SUBJ:V-N------------------------------------------------------+     |                                 
           +------------------------------------------------------OBJ:V-N-----------------------------------------------------+          |     |                                 
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |          |     +-----COMP:V_PASS-N(by)-----+     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+--SUBJ:V_PASS-N-+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
OBJ:V-N (decrease,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,bind)
SUBJ:V-N (be,protein)
SUBJ:V_PASS-N (increase,bind)
SUBJ:V_PASS-N (increase,protein)
COMP:V_PASS-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 306
                    +---------------------------------------------------------------------COMP:N-N(by)---------------------------------------------------------------------+     
                    +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+                           |     
           +--------------------------------------------------OBJ:V-N-------------------------------------------------+--------------------COMP:N-N(by)--------------------+     
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 +---------OBJ:V-N--------+                           |     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |       +----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
OBJ:V-N (decrease,__NODE__)
COMP:N-N(of) (bind,fragment)
COMP:N-N(by) (bind,protein)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(by) (__NODE__,protein)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,bind)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 307
                    +---------------------------------------------------------------------COMP:N-N(by)---------------------------------------------------------------------+     
                    +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+                           |     
           +----------------------------------------------OBJ:V-N---------------------------------------------+------------------------COMP:N-N(by)------------------------+     
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         +-------------OBJ:V-N------------+                           |     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |               +----SUBJ:V-N----+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
OBJ:V-N (decrease,__SP__)
COMP:N-N(of) (bind,fragment)
COMP:N-N(by) (bind,protein)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:N-N(by) (__SP__,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,bind)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 308
                    +-------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------+             
                    +-------------------------------------------------------------COMP:N-N(by)-------------------------------------------------------------+       |             
                    +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+           |       |             
                    |                                                                                                 +------------------SUBJ:V-N------------------+             
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 +------------COMP:N-N(by)------------+       |             
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 +---------OBJ:V-N--------+           |       |             
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +----SUBJ:V-N----+           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
COMP:N-N(by) (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(by) (__NODE__,__SP__)
OBJ:V-N (increase,bind)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__NODE__)
OBJ:V-N (__NODE__,protein)

Analyse 309
                    +---------------------------------------------SUBJ:V-N--------------------------------------------+                                                          
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |                        +-----COMP:V_PASS-N(by)-----+     
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |       +--SUBJ:V_PASS-N-+           +-MOD_ATT:N-ADJ-+     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)
SUBJ:V-N (be,protein)
SUBJ:V_PASS-N (increase,protein)
COMP:V_PASS-N(by) (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 310
                    +-------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------+             
                    +-------------------------------------------------------------COMP:N-N(by)-------------------------------------------------------------+       |             
                    +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+           |       |             
                    |                                                                                         +----------------------SUBJ:V-N----------------------+             
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         +----------------COMP:N-N(by)----------------+       |             
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-------------OBJ:V-N------------+           |       |             
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+----SUBJ:V-N----+           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
COMP:N-N(by) (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:N-N(by) (__SP__,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,bind)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 311
                    +---------------------------------------------------------------------COMP:N-N(by)---------------------------------------------------------------------+     
                    +-------------------------------------------------------SUBJ:V_PASS-N------------------------------------------------------+                           |     
                    +------------------------------------------------------SUBJ:V-N------------------------------------------------------+     |                           |     
           +------------------------------------------------------OBJ:V-N-----------------------------------------------------+          |     |                           |     
           |        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         +----------------COMP:N-N(by)----------------+     
           |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+--SUBJ:V_PASS-N-+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
OBJ:V-N (decrease,protein)
COMP:N-N(of) (bind,fragment)
COMP:N-N(by) (bind,protein)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:N-N(by) (protein,protein)
SUBJ:V-N (be,bind)
SUBJ:V-N (be,protein)
SUBJ:V_PASS-N (increase,bind)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 312
                    +---------------------------------------------SUBJ:V-N--------------------------------------------+                                                          
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |       +----------------COMP:N-N(by)----------------+     
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |       |                            +-MOD_ATT:N-ADJ-+     
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+--SUBJ:V_PASS-N-+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)
COMP:N-N(by) (protein,protein)
SUBJ:V_PASS-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 313
                                                                                                    +-----------------------------COMP:N-N(by)-----------------------------+     
                                                                         +-------------------OBJ:V-N------------------+--------------------COMP:N-N(by)--------------------+     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+------------------OBJ:V-N-----------------+                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 +---------OBJ:V-N--------+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +----SUBJ:V-N----+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:N-N(by) (site,protein)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(by) (__NODE__,protein)
OBJ:V-N (increase,site)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 314
                                                                                                    +-----------------------------COMP:N-N(by)-----------------------------+     
                                                                         +---------------OBJ:V-N--------------+------------------------COMP:N-N(by)------------------------+     
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+------------------OBJ:V-N-----------------+                           |     
                    +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-------------OBJ:V-N------------+           +-MOD_ATT:N-ADJ-+     
   +SUBJ:V-+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+----SUBJ:V-N----+           |       +MOD_ATT+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
SUBJ:V-N (decrease,U0126)
OBJ:V-N (decrease,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:N-N(by) (site,protein)
COMP:N-N(by) (__SP__,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,site)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 315
                    +-------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------+             
                    |                                                                                                 +------------------SUBJ:V-N------------------+             
                    |                                                                                                 +------------COMP:N-N(by)------------+       |             
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 +---------OBJ:V-N--------+           |       |             
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |       +----SUBJ:V-N----+           |       |             
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +-SUBJ:V-N-+     |           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(by) (__NODE__,__SP__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__NODE__)
OBJ:V-N (__NODE__,protein)

Analyse 316
                    +-------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------+             
                    |                                                                                         +----------------------SUBJ:V-N----------------------+             
                    |                                                                                         +----------------COMP:N-N(by)----------------+       |             
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         +-------------OBJ:V-N------------+           |       |             
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |               +----SUBJ:V-N----+           |       |             
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:N-N(by) (__SP__,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 317
                    +-------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------+             
                    +-------------------------------------------------------------COMP:N-N(by)-------------------------------------------------------------+       |             
                    +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+           |       |             
                    |                                                                                         +----------------------SUBJ:V-N----------------------+             
                    |                                                                                         +----------------COMP:N-N(by)----------------+       |             
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         +-------------OBJ:V-N------------+           |       |             
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |               +----SUBJ:V-N----+           |       |             
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+-SUBJ:V-N-+     |           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |          |     |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
COMP:N-N(by) (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:N-N(by) (__SP__,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (increase,bind)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 318
                    +-------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------+             
                    +-------------------------------------------------------------COMP:N-N(by)-------------------------------------------------------------+       |             
                    +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+           |       |             
                    |                                                                                         +----------------------SUBJ:V-N----------------------+             
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         +----------------COMP:N-N(by)----------------+       |             
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-------------OBJ:V-N------------+           |       |             
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+----SUBJ:V-N----+           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
COMP:N-N(by) (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:N-N(by) (__SP__,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,bind)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 319
                    +-------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------+             
                    +-------------------------------------------------------------COMP:N-N(by)-------------------------------------------------------------+       |             
                    +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+           |       |             
                    |                                                                                                 +------------------SUBJ:V-N------------------+             
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 +------------COMP:N-N(by)------------+       |             
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 +---------OBJ:V-N--------+           |       |             
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +----SUBJ:V-N----+           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
COMP:N-N(by) (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(by) (__NODE__,__SP__)
OBJ:V-N (increase,bind)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__NODE__)
OBJ:V-N (__NODE__,protein)

Analyse 320
                    +-------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------+             
                    +-------------------------------------------------------------COMP:N-N(by)-------------------------------------------------------------+       |             
                    +----------------------------------------------------------OBJ:V-N---------------------------------------------------------+           |       |             
                    |                                                                                                 +------------------SUBJ:V-N------------------+             
                    +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 +------------COMP:N-N(by)------------+       |             
   +---MOD_ATT:N-N--+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 +---------OBJ:V-N--------+           |       |             
   |       +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +MOD_ATT+       +----SUBJ:V-N----+           |       +OBJ:V-N+     
   |       |        |          |      |                |                 |           |       |      |         |       |       |                |           |       |       |     
 U0126 decreases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein that is increased by __SP__ __NODE__ protein .
MOD_ATT:N-N (bind,U0126)
MOD_ATT:N-N (bind,decrease)
COMP:N-N(of) (bind,fragment)
COMP:N-N(by) (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(by) (__NODE__,__SP__)
OBJ:V-N (increase,bind)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__NODE__)
OBJ:V-N (__NODE__,protein)