vers la météo de la validation par utilisateur

Ingenuity440


precedent - 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 - suivant

Phrase 54 - PMID ?

WY 14643 in stomach from __SP__ increases binding of a DNA fragment ( GAACTAGGTCAAAGGTCATCCCCT ) containing a PPRE in nuclear extract from __SP__ liver and a protein protein complex consisting of __SP__ __NODE__ and of __SP__ __NODE__ in nuclear extract from __SP__ liver that is decreased by __NODE__ in stomach from __SP__ .


Non annotée
Je ne sais pas
Je n'ai pas trouvé d'analyse satisfaisante


Commentaires :

Analyse 0
                                                                                                                                                                                                                                                                       +----------MOD_POST:N-ADJ----------+                            
                                                                                                                                                     +---------------SUBJ:V-N---------------+                   +---------------COMP:N-N(in)--------------+            +-------OBJ:V-N-------+            |                            
  +-------------SUBJ:V-N-------------+        +---COMP:N-N(of)--+                                                                 +--COMP:N-N(from)--+            +--MOD_ATT:N-N--+         +----COMP:N-N(of)---+-----COMP:N-N(of)-----+                  |            |     +----SUBJ:V-N---+            +-----COMP:ADJ-N(in)----+    
  |   +-----COMP:N-N(in)-----+       +-OBJ:V-N+          +MOD_AT+-------APPOS------+                   +-OBJ:V-N-+        +MOD_ATT+            +MOD_A+            |       +MOD_ATT+-SUBJ:V-N+           +MOD_ATT+              +MOD_ATT+          +MOD_ATT+COMP:N-N(fro+     +-SUBJ:V-N+     +MOD:V-+     |          +-MOD_ATT:N-N+    
  |   |                      |       |        |          |      |                  |                   |         |        |       |            |     |            |       |       |         |           |       |              |       |          |       |            |     |         |     |      |     |          |            |    
 WY 14643 in stomach from __SP__ increases binding of a DNA fragment ( GAACTAGGTCAAAGGTCATCCCCT ) containing a PPRE in nuclear extract from __SP__ liver and a protein protein complex consisting of __SP__ __NODE__ and of __SP__ __NODE__ in nuclear extract from __SP__ liver that is decreased by __NODE__ in stomach from __SP__ .
COMP:N-N(in) (@card@,__SP__)
SUBJ:V-N (increase,WY)
OBJ:V-N (increase,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GAACTAGGTCAAAGGTCATCCCCT)
OBJ:V-N (contain,PPRE)
MOD_ATT:N-ADJ (extract,nuclear)
COMP:N-N(from) (extract,liver)
MOD_ATT:N-ADJ (liver,__SP__)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,liver)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,__NODE__)
COMP:N-N(in) (__NODE__,extract)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (extract,nuclear)
COMP:N-N(from) (extract,__SP__)
MOD_POST:N-ADJ (__SP__,__NODE__)
SUBJ:V-N (be,liver)
OBJ:V-N (decrease,__SP__)
SUBJ:V-N (decrease,liver)
MOD:V-ADV (decrease,by)
COMP:ADJ-N(in) (__NODE__,__SP__)
MOD_ATT:N-N (__SP__,stomach)

Analyse 1
                +-----------OBJ:V-N-----------+----------------APPOS---------------+                                              +-------------COMP:N-N(from)------------+                 +-----------COMP:N-N(of)-----------+                          +-----------SUBJ:V_PASS-N----------+                                         
                +---COMP:V-N(from)---+        +---COMP:N-N(of)--+                  |                                              +--COMP:N-N(from)--+---------------SUBJ:V-N---------------+----COMP:N-N(of)---+              |       +--COMP:ADJ-N(in)--+--COMP:N-N(from)--+               +----------COMP:V_PASS-N(in)---------+    
      +-SUBJ:V-N+            +MOD_ATT+        |          +MOD_AT+                  |                   +-OBJ:V-N-+        +MOD_ATT+            +MOD_A+            +MOD_ATT+-----SUBJ:V-N----+           +MOD_ATT+              +MOD_POS+          +MOD_ATT+            +MOD_A+               +COMP:V_PASS-+          +-MOD_ATT:N-N+    
      |         |            |       |        |          |      |                  |                   |         |        |       |            |     |            |       |                 |           |       |              |       |          |       |            |     |               |            |          |            |    
 WY 14643 in stomach from __SP__ increases binding of a DNA fragment ( GAACTAGGTCAAAGGTCATCCCCT ) containing a PPRE in nuclear extract from __SP__ liver and a protein protein complex consisting of __SP__ __NODE__ and of __SP__ __NODE__ in nuclear extract from __SP__ liver that is decreased by __NODE__ in stomach from __SP__ .
SUBJ:V-N (stomach,@card@)
COMP:V-N(from) (stomach,increase)
OBJ:V-N (stomach,bind)
MOD_ATT:N-ADJ (increase,__SP__)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GAACTAGGTCAAAGGTCATCCCCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,PPRE)
MOD_ATT:N-ADJ (extract,nuclear)
COMP:N-N(from) (extract,liver)
COMP:N-N(from) (extract,protein)
MOD_ATT:N-ADJ (liver,__SP__)
MOD_ATT:N-N (protein,protein)
SUBJ:V-N (consist,liver)
SUBJ:V-N (consist,protein)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__SP__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_POST:N-ADJ (__SP__,__NODE__)
COMP:ADJ-N(in) (__NODE__,extract)
MOD_ATT:N-ADJ (extract,nuclear)
COMP:N-N(from) (extract,liver)
MOD_ATT:N-ADJ (liver,__SP__)
SUBJ:V_PASS-N (decrease,extract)
COMP:V_PASS-N(by) (decrease,__NODE__)
COMP:V_PASS-N(in) (decrease,__SP__)
MOD_ATT:N-N (__SP__,stomach)