vers la météo de la validation par utilisateur

Ingenuity017

precedent - 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 - suivant

Phrase 12 - PMID ?

Binding of a DNA fragment ( 154 130 ) ( 5 ' ATCCCATGCGCGAGGGCGGGCGCAA 3 ' containing a __NODE__ binding site 2 from __SP__ __NODE__ gene and a protein protein complex consisting of __SP__ __NODE__ and of __SP__ __NODE__ and of __SP__ __NODE__ occurs in a system of purified components .


Non annotée
Je ne sais pas
Je n'ai pas trouvé d'analyse satisfaisante


Commentaires :
Analyse 0 
                                                                                +----------OBJ:V-N---------+                    +------------------SUBJ:V-N------------------+-----------------------COMP:N-N(of)----------------------+------------------COMP:N-N(of)------------------+      
    +-----OBJ:V-N-----+-------APPOS------+                                      |           +-MOD_ATT:N-ADJ+  +--COMP:N-N(from)-+                  +--MOD_ATT:N-N--+         +---------------COMP:N-N(of)---------------+              +----OBJ:V-N----+                                |      
    |          +MOD_AT+-APPOS-+          +---------------SUBJ:V-N---------------+           |       +MOD_AT+  |         +MOD_ATT+                  |       +MOD_ATT+-SUBJ:V-N+----COMP:N-N(of)---+              +MOD_ATT+              |       +SUBJ:V-+MOD:+                 +MOD_ATT:N+      
    |          |      |       |          |                                      |           |       |      |  |         |       |                  |       |       |         |                   |              |       |              |       |       |    |                 |         |      
 Binding of a DNA fragment ( 154 130 ) ( 5 ' ATCCCATGCGCGAGGGCGGGCGCAA 3 ' containing a __NODE__ binding site 2 from __SP__ __NODE__ gene and a protein protein complex consisting of __SP__ __NODE__ and of __SP__ __NODE__ and of __SP__ __NODE__ occurs in a system of purified components .
OBJ:V-N (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,@card@)
APPOS (fragment,5)
SUBJ:V-N (contain,5)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:N-N(from) (2,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,__NODE__)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__SP__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__SP__,component)
OBJ:V-N (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
MOD:V-ADV (occur,in)
MOD_ATT:N-ADJ (component,purify)