Validation pour Ingenuity017

vers la météo de la validation par utilisateur

Ingenuity017

precedent - 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 - suivant

Phrase 2 - PMID ?

Binding of a DNA fragment ( 145 121 ) ( 5 ' GCGAGGGCGGGCGCAAGGGCGGCCA 3 ' containing a NODE binding site 1 2 from SP NODE gene and a protein protein complex consisting of SP NODE and of SP NODE and of SP NODE occurs in a system of purified components .

Non annotée
Je ne sais pas
Je n'ai pas trouvé d'analyse satisfaisante

Commentaires :

Analyse 0

                                                                                                                                                                               +-----------------------COMP:N-N(of)----------------------+                                                       
                                                                                +----------OBJ:V-N---------+                             +---------------SUBJ:V-N--------------+---------------COMP:N-N(of)---------------+              |                                                       
    +-----OBJ:V-N-----+           +---------APPOS--------+                      |           +-MOD_ATT:N-ADJ+                             |           +--MOD_ATT:N-N--+         |                                  +-----MOD_ATT:N-ADJ----+--------COMP:N-N(in)-------+----COMP:N-N(of)----+      
    |          +MOD_AT+-APPOS-+   |      +-MOD_ATT:N-ADJ-+             +SUBJ:V-N+           |       +MOD_AT+    +-SUBJ:V-N+       +MOD_AT+           |       +MOD_ATT+-SUBJ:V-N+COMP:N-N(of+                      +MOD_ATT+              |       +SUBJ:V-+           |          +MOD_ATT:N+      
    |          |      |       |   |      |               |             |        |           |       |      |    |         |       |      |           |       |       |         |           |                      |       |              |       |       |           |          |         |      
 Binding of a DNA fragment ( 145 121 ) ( 5 ' GCGAGGGCGGGCGCAAGGGCGGCCA 3 ' containing a __NODE__ binding site 1 2 from __SP__ __NODE__ gene and a protein protein complex consisting of __SP__ __NODE__ and of __SP__ __NODE__ and of __SP__ __NODE__ occurs in a system of purified components .
OBJ:V-N (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,@card@)
APPOS (@card@,GCGAGGGCGGGCGCAAGGGCGGCCA)
MOD_ATT:N-ADJ (GCGAGGGCGGGCGCAAGGGCGGCCA,5)
SUBJ:V-N (contain,3)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
SUBJ:V-N (__SP__,2)
MOD_ATT:N-ADJ (gene,__NODE__)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,gene)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__SP__)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__SP__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (__SP__,__SP__)
COMP:N-N(in) (__SP__,system)
SUBJ:V-N (occur,__NODE__)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 1

                                                                                                              +------------------------------------COMP:N-N(of)------------------------------------+                                                                                             
                                                                                +-----------OBJ:V-N-----------+------OBJ:V-N------+                                                                +---------------------------COMP:N-N(of)--------------------------+                           
    +-----OBJ:V-N-----+                                                         |           +-MOD_ATT:N-ADJ+  | +-----SUBJ:V-N----+                  +--MOD_ATT:N-N--+---------COMP:N-N(of)--------+-----COMP:N-N(of)-----+              +----OBJ:V-N----+           +----COMP:N-N(of)----+      
    |          +MOD_AT+---APPOS---+----------------APPOS---------------+        |           |       +MOD_AT+  | +COMP:N-N(+       |                  |       +MOD_ATT+                     +MOD_ATT+              +MOD_ATT+              |       +SUBJ:V-+MOD:+      |          +MOD_ATT:N+      
    |          |      |           |                                    |        |           |       |      |  | |         |       |                  |       |       |                     |       |              |       |              |       |       |    |      |          |         |      
 Binding of a DNA fragment ( 145 121 ) ( 5 ' GCGAGGGCGGGCGCAAGGGCGGCCA 3 ' containing a __NODE__ binding site 1 2 from __SP__ __NODE__ gene and a protein protein complex consisting of __SP__ __NODE__ and of __SP__ __NODE__ and of __SP__ __NODE__ occurs in a system of purified components .
OBJ:V-N (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,@card@)
APPOS (@card@,3)
OBJ:V-N (contain,1)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:N-N(of) (1,__NODE__)
COMP:N-N(from) (2,__SP__)
OBJ:V-N (__NODE__,1)
SUBJ:V-N (__NODE__,2)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,__NODE__)
COMP:N-N(of) (__NODE__,system)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
MOD:V-ADV (occur,in)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)