Validation pour Ingenuity023

vers la météo de la validation par utilisateur

Ingenuity023

precedent - 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 - suivant

Phrase 37 - PMID ?

Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGAGGTAATATC ) from SP NODE gene and a protein protein complex consisting of NODE does not occur in a cell free system .

Non annotée
Je ne sais pas
Je n'ai pas trouvé d'analyse satisfaisante

Commentaires :

Analyse 0

    +-------------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------------+                          
    +--------------------------------------------------COMP:N-N(from)--------------------------------------------------+                                      |                          
    +---------------------------------COMP:N-N(from)--------------------------------+------------------SUBJ:V-N------------------+                            +-----COMP:V-N(in)----+    
    +---COMP:N-N(of)--+                                                             |                  +--MOD_ATT:N-N--+         |                            |          +MOD_ATT:N-+    
    |          +MOD_AT+----------APPOS---------+                            +MOD_ATT+                  |       +MOD_ATT+-SUBJ:V-N+COMP:N-N(of)+          +-NEG+          |    +MOD_A+    
    |          |      |                        |                            |       |                  |       |       |         |            |          |    |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGAGGTAATATC ) from __SP__ __NODE__ gene and a protein protein complex consisting of __NODE__ does not occur in a cell free system .
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,__NODE__)
COMP:N-N(from) (bind,complex)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGAGGTAATATC)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,__NODE__)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
SUBJ:V-N (occur,bind)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 1

    +-------------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------------+                          
    +--------------------------------------------------COMP:N-N(from)--------------------------------------------------+                                      |                          
    +---------------------------------COMP:N-N(from)--------------------------------+                                  |                                      +-----COMP:V-N(in)----+    
    +---COMP:N-N(of)--+                                                             |                  +--MOD_ATT:N-N--+                                      |          +MOD_ATT:N-+    
    |          +MOD_AT+----------APPOS---------+                            +MOD_ATT+                  |       +MOD_ATT+-SUBJ:V-N+COMP:N-N(of)+          +-NEG+          |    +MOD_A+    
    |          |      |                        |                            |       |                  |       |       |         |            |          |    |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGAGGTAATATC ) from __SP__ __NODE__ gene and a protein protein complex consisting of __NODE__ does not occur in a cell free system .
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,__NODE__)
COMP:N-N(from) (bind,complex)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGAGGTAATATC)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
SUBJ:V-N (occur,bind)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 2

    +-------------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------------+                          
    |                                                                       +--------------------MOD_ATT:N-ADJ-------------------+                            |                          
    |                                                                       |       +----------------MOD_ATT:N-ADJ---------------+                            |                          
    |                                                                       |       |      +-------------MOD_ATT:N-N-------------+                            |                          
    |                                                                       |       |      |           +-------MOD_ATT:N-N-------+                            +-----COMP:V-N(in)----+    
    +---COMP:N-N(of)--+                                                     |       |      |           |       +---MOD_ATT:N-N---+                            |          +MOD_ATT:N-+    
    |          +MOD_AT+----------APPOS---------+                            |       |      |           |       |       +MOD_ATT:N+COMP:N-N(of)+          +-NEG+          |    +MOD_A+    
    |          |      |                        |                            |       |      |           |       |       |         |            |          |    |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGAGGTAATATC ) from __SP__ __NODE__ gene and a protein protein complex consisting of __NODE__ does not occur in a cell free system .
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGAGGTAATATC)
MOD_ATT:N-ADJ (consist,__SP__)
MOD_ATT:N-ADJ (consist,__NODE__)
MOD_ATT:N-N (consist,gene)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
SUBJ:V-N (occur,bind)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 3

    +-------------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------------+                          
    +--------------------------------------------------COMP:N-N(from)--------------------------------------------------+                                      |                          
    +---------------------------------COMP:N-N(from)--------------------------------+------------------SUBJ:V-N------------------+                            +-----COMP:V-N(in)----+    
    +---COMP:N-N(of)--+                                                             |                  +--MOD_ATT:N-N--+         |                            |          +MOD_ATT:N-+    
    |          +MOD_AT+----------APPOS---------+                            +MOD_ATT+                  |       +MOD_ATT+-SUBJ:V-N+COMP:N-N(of)+          +-NEG+          |    +MOD_A+    
    |          |      |                        |                            |       |                  |       |       |         |            |          |    |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGAGGTAATATC ) from __SP__ __NODE__ gene and a protein protein complex consisting of __NODE__ does not occur in a cell free system .
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,__NODE__)
COMP:N-N(from) (bind,complex)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGAGGTAATATC)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,__NODE__)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
SUBJ:V-N (occur,bind)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 4

    +-------------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------------+                          
    +--------------------------------------------------COMP:N-N(from)--------------------------------------------------+                                      |                          
    +---------------------------------COMP:N-N(from)--------------------------------+                                  |                                      +-----COMP:V-N(in)----+    
    +---COMP:N-N(of)--+                                                             |                  +--MOD_ATT:N-N--+                                      |          +MOD_ATT:N-+    
    |          +MOD_AT+----------APPOS---------+                            +MOD_ATT+                  |       +MOD_ATT+-SUBJ:V-N+COMP:N-N(of)+          +-NEG+          |    +MOD_A+    
    |          |      |                        |                            |       |                  |       |       |         |            |          |    |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGAGGTAATATC ) from __SP__ __NODE__ gene and a protein protein complex consisting of __NODE__ does not occur in a cell free system .
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,__NODE__)
COMP:N-N(from) (bind,complex)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGAGGTAATATC)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
SUBJ:V-N (occur,bind)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 5

    +-------------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------------+                          
    +-------------------------------------------------------COMP:N-N(from)-------------------------------------------------------+                            |                          
    |                                                                       +--------------------MOD_ATT:N-ADJ-------------------+                            |                          
    |                                                                       |       +----------------MOD_ATT:N-ADJ---------------+                            |                          
    |                                                                       |       |      +-------------MOD_ATT:N-N-------------+                            |                          
    |                                                                       |       |      |           +-------MOD_ATT:N-N-------+                            +-----COMP:V-N(in)----+    
    +---COMP:N-N(of)--+                                                     |       |      |           |       +---MOD_ATT:N-N---+                            |          +MOD_ATT:N-+    
    |          +MOD_AT+----------APPOS---------+                            |       |      |           |       |       +MOD_ATT:N+COMP:N-N(of)+          +-NEG+          |    +MOD_A+    
    |          |      |                        |                            |       |      |           |       |       |         |            |          |    |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGAGGTAATATC ) from __SP__ __NODE__ gene and a protein protein complex consisting of __NODE__ does not occur in a cell free system .
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,consist)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGAGGTAATATC)
MOD_ATT:N-ADJ (consist,__SP__)
MOD_ATT:N-ADJ (consist,__NODE__)
MOD_ATT:N-N (consist,gene)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
SUBJ:V-N (occur,bind)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 6

    +-------------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------------+                          
    |                                                                       +--------------------MOD_ATT:N-ADJ-------------------+                            |                          
    |                                                                       |       +----------------MOD_ATT:N-ADJ---------------+                            |                          
    |                                                                       |       |      +-------------MOD_ATT:N-N-------------+                            |                          
    |                                                                       |       |      |           +-------MOD_ATT:N-N-------+                            +-----COMP:V-N(in)----+    
    +---COMP:N-N(of)--+                                                     |       |      |           |       +---MOD_ATT:N-N---+                            |          +MOD_ATT:N-+    
    |          +MOD_AT+----------APPOS---------+                            |       |      |           |       |       +MOD_ATT:N+COMP:N-N(of)+          +-NEG+          |    +MOD_A+    
    |          |      |                        |                            |       |      |           |       |       |         |            |          |    |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGAGGTAATATC ) from __SP__ __NODE__ gene and a protein protein complex consisting of __NODE__ does not occur in a cell free system .
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGAGGTAATATC)
MOD_ATT:N-ADJ (consist,__SP__)
MOD_ATT:N-ADJ (consist,__NODE__)
MOD_ATT:N-N (consist,gene)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
SUBJ:V-N (occur,bind)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 7

    +-------------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------------+                          
    +-------------------------------------------------------COMP:N-N(from)-------------------------------------------------------+                            |                          
    |                                                                       +--------------------MOD_ATT:N-ADJ-------------------+                            |                          
    |                                                                       |       +----------------MOD_ATT:N-ADJ---------------+                            |                          
    |                                                                       |       |      +-------------MOD_ATT:N-N-------------+                            |                          
    |                                                                       |       |      |           +-------MOD_ATT:N-N-------+                            +-----COMP:V-N(in)----+    
    +---COMP:N-N(of)--+                                                     |       |      |           |       +---MOD_ATT:N-N---+                            |          +MOD_ATT:N-+    
    |          +MOD_AT+----------APPOS---------+                            |       |      |           |       |       +MOD_ATT:N+COMP:N-N(of)+          +-NEG+          |    +MOD_A+    
    |          |      |                        |                            |       |      |           |       |       |         |            |          |    |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGAGGTAATATC ) from __SP__ __NODE__ gene and a protein protein complex consisting of __NODE__ does not occur in a cell free system .
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,consist)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGAGGTAATATC)
MOD_ATT:N-ADJ (consist,__SP__)
MOD_ATT:N-ADJ (consist,__NODE__)
MOD_ATT:N-N (consist,gene)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
SUBJ:V-N (occur,bind)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)