vers la météo de la validation par utilisateur

Ingenuity023

precedent - 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 - suivant

Phrase 38 - PMID ?

Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .


Non annotée
Je ne sais pas
Je n'ai pas trouvé d'analyse satisfaisante


Commentaires :
Analyse 0 
                                                                                   +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                                                                                   |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                                                                                   |       |                                      +---------------------------SUBJ:V-N---------------------------+                          
                                                                                   |       |                                      +-----------------------OBJ:V-N-----------------------+        |                          
                                                                                   |       |                                      |                 +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
    +-----OBJ:V-N-----+                                                            |       |                                      |                 +--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
    |          +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             +MOD_ATT+       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
    |          |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 1 
                                                                                   +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                                                                                   |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                                                                                   |       |                                      +---------------------------SUBJ:V-N---------------------------+                          
                                                                                   |       |                                      +-----------------------OBJ:V-N-----------------------+        |                          
                                                                                   |       |                                      |                 +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
    +-----OBJ:V-N-----+                                                            |       |                                      |                 +--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
    |          +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             +MOD_ATT+       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
    |          |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 2 
                                                                                   +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                                                                                   |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                                                                                   |       |                                      +---------------------------SUBJ:V-N---------------------------+                          
                                                                                   |       |                                      +-----------------------OBJ:V-N-----------------------+        |                          
                                                                                   |       |                                      |                 +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
    +-----OBJ:V-N-----+                                                            |       |                                      |                 +--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
    |          +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             +MOD_ATT+       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
    |          |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 3 
                                                                                   +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                                                                                   |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                                                                                   |       |                                      +---------------------------SUBJ:V-N---------------------------+                          
                                                                                   |       |                                      +-----------------------OBJ:V-N-----------------------+        |                          
                                                                                   |       |                                      |                 +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
    +-----OBJ:V-N-----+                                                            |       |                                      |                 +--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
    |          +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             +MOD_ATT+       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
    |          |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 4 
                                                                                   +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                                                                                   |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                                                                                   |       |                              +-------------------------------SUBJ:V-N-------------------------------+                          
                                                                                   |       |                              +---------------------------OBJ:V-N---------------------------+        |                          
                                                                                   |       |                              |                         +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
    +-----OBJ:V-N-----+                                                            |       |                              |       +---MOD_ATT:N-N---+--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
    |          +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             |       |       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
    |          |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 5 
                                                                                   +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                                                                                   |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                                                                                   |       |                                              +-----------------------SUBJ:V-N-----------------------+                          
                                                                                   |       |                                              +-------------------OBJ:V-N-------------------+        |                          
                                                                                   |       |                                              |         +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
    +-----OBJ:V-N-----+                                                            |       |                              +--MOD_ATT:N-N--+         +--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
    |          +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             |       +MOD_ATT+         +COMP:N-N(of)+               |      |        |          |    +MOD_A+    
    |          |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,complex)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,complex)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 6 
                                                                                   +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                                                                                   |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                                                                                   |       |                              +-------------------------------SUBJ:V-N-------------------------------+                          
                                                                                   |       |                              +---------------------------OBJ:V-N---------------------------+        |                          
                                                                                   |       |                              |                         +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
    +-----OBJ:V-N-----+                                                            |       |                              |       +---MOD_ATT:N-N---+--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
    |          +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             |       |       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
    |          |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 7 
                                                                                   +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                                                                                   |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                                                                                   |       |                                              +-----------------------SUBJ:V-N-----------------------+                          
                                                                                   |       |                                              +-------------------OBJ:V-N-------------------+        |                          
                                                                                   |       |                                              |         +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
    +-----OBJ:V-N-----+                                                            |       |                              +--MOD_ATT:N-N--+         +--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
    |          +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             |       +MOD_ATT+         +COMP:N-N(of)+               |      |        |          |    +MOD_A+    
    |          |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,complex)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,complex)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 8 
                                                                                   +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                                                                                   |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                                                                                   |       |                                      +---------------------------SUBJ:V-N---------------------------+                          
                                                                                   |       |                                      +-----------------------OBJ:V-N-----------------------+        |                          
                                                                                   |       |                                      |                 +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
    +-----OBJ:V-N-----+                                                            |       |                                      |                 +--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
    |          +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             +MOD_ATT+       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
    |          |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 9 
                                                                                   +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                                                                                   |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                                                                                   |       |                                      +---------------------------SUBJ:V-N---------------------------+                          
                                                                                   |       |                                      +-----------------------OBJ:V-N-----------------------+        |                          
                                                                                   |       |                                      |                 +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
    +-----OBJ:V-N-----+                                                            |       |                                      |                 +--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
    |          +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             +MOD_ATT+       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
    |          |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 10 
                                                                                   +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                                                                                   |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                                                                                   |       |                                      +---------------------------SUBJ:V-N---------------------------+                          
                                                                                   |       |                                      +-----------------------OBJ:V-N-----------------------+        |                          
                                                                                   |       |                                      |                 +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
    +-----OBJ:V-N-----+                                                            |       |                                      |                 +--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
    |          +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             +MOD_ATT+       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
    |          |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 11 
                                                                                   +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                                                                                   |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                                                                                   |       |                                      +---------------------------SUBJ:V-N---------------------------+                          
                                                                                   |       |                                      +-----------------------OBJ:V-N-----------------------+        |                          
                                                                                   |       |                                      |                 +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
    +-----OBJ:V-N-----+                                                            |       |                                      |                 +--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
    |          +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             +MOD_ATT+       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
    |          |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 12 
                                                                                   +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                                                                                   |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                                                                                   |       |                              +-------------------------------SUBJ:V-N-------------------------------+                          
                                                                                   |       |                              +---------------------------OBJ:V-N---------------------------+        |                          
                                                                                   |       |                              |                         +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
    +-----OBJ:V-N-----+                                                            |       |                              |       +---MOD_ATT:N-N---+--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
    |          +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             |       |       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
    |          |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 13 
                                                                                   +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                                                                                   |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                                                                                   |       |                                              +-----------------------SUBJ:V-N-----------------------+                          
                                                                                   |       |                                              +-------------------OBJ:V-N-------------------+        |                          
                                                                                   |       |                                              |         +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
    +-----OBJ:V-N-----+                                                            |       |                              +--MOD_ATT:N-N--+         +--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
    |          +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             |       +MOD_ATT+         +COMP:N-N(of)+               |      |        |          |    +MOD_A+    
    |          |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,complex)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,complex)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 14 
                                                                                   +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                                                                                   |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                                                                                   |       |                              +-------------------------------SUBJ:V-N-------------------------------+                          
                                                                                   |       |                              +---------------------------OBJ:V-N---------------------------+        |                          
                                                                                   |       |                              |                         +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
    +-----OBJ:V-N-----+                                                            |       |                              |       +---MOD_ATT:N-N---+--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
    |          +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             |       |       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
    |          |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 15 
                                                                                   +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                                                                                   |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                                                                                   |       |                                              +-----------------------SUBJ:V-N-----------------------+                          
                                                                                   |       |                                              +-------------------OBJ:V-N-------------------+        |                          
                                                                                   |       |                                              |         +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
    +-----OBJ:V-N-----+                                                            |       |                              +--MOD_ATT:N-N--+         +--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
    |          +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             |       +MOD_ATT+         +COMP:N-N(of)+               |      |        |          |    +MOD_A+    
    |          |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,complex)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,complex)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 16 
                      +-------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------+                          
                      |                                                            +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                      |                                                            |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                      |                                                            |       |                                      +---------------------------SUBJ:V-N---------------------------+                          
                      |                                                            |       |                                      +-----------------------OBJ:V-N-----------------------+        |                          
                      |                                                            |       |                                      |                 +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
                      |                                                            |       |                                      |                 +--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
               +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             +MOD_ATT+       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
               |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,fragment)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 17 
                      +-------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------+                          
                      |                                                            +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                      |                                                            |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                      |                                                            |       |                                      +---------------------------SUBJ:V-N---------------------------+                          
                      |                                                            |       |                                      +-----------------------OBJ:V-N-----------------------+        |                          
                      |                                                            |       |                                      |                 +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
                      |                                                            |       |                                      |                 +--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
               +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             +MOD_ATT+       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
               |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,fragment)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 18 
                      +-------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------+                          
                      |                                                            +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                      |                                                            |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                      |                                                            |       |                                      +---------------------------SUBJ:V-N---------------------------+                          
                      |                                                            |       |                                      +-----------------------OBJ:V-N-----------------------+        |                          
                      |                                                            |       |                                      |                 +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
                      |                                                            |       |                                      |                 +--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
               +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             +MOD_ATT+       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
               |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,fragment)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 19 
                      +-------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------+                          
                      |                                                            +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                      |                                                            |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                      |                                                            |       |                                      +---------------------------SUBJ:V-N---------------------------+                          
                      |                                                            |       |                                      +-----------------------OBJ:V-N-----------------------+        |                          
                      |                                                            |       |                                      |                 +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
                      |                                                            |       |                                      |                 +--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
               +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             +MOD_ATT+       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
               |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,fragment)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 20 
                      +-------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------+                          
                      |                                                            +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                      |                                                            |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                      |                                                            |       |                              +-------------------------------SUBJ:V-N-------------------------------+                          
                      |                                                            |       |                              +---------------------------OBJ:V-N---------------------------+        |                          
                      |                                                            |       |                              |                         +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
                      |                                                            |       |                              |       +---MOD_ATT:N-N---+--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
               +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             |       |       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
               |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,fragment)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 21 
                      +-------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------+                          
                      |                                                            +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                      |                                                            |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                      |                                                            |       |                                              +-----------------------SUBJ:V-N-----------------------+                          
                      |                                                            |       |                                              +-------------------OBJ:V-N-------------------+        |                          
                      |                                                            |       |                                              |         +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
                      |                                                            |       |                              +--MOD_ATT:N-N--+         +--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
               +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             |       +MOD_ATT+         +COMP:N-N(of)+               |      |        |          |    +MOD_A+    
               |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,complex)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,fragment)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,complex)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 22 
                      +-------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------+                          
                      |                                                            +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                      |                                                            |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                      |                                                            |       |                              +-------------------------------SUBJ:V-N-------------------------------+                          
                      |                                                            |       |                              +---------------------------OBJ:V-N---------------------------+        |                          
                      |                                                            |       |                              |                         +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
                      |                                                            |       |                              |       +---MOD_ATT:N-N---+--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
               +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             |       |       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
               |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,fragment)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 23 
                      +-------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------+                          
                      |                                                            +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                      |                                                            |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                      |                                                            |       |                                              +-----------------------SUBJ:V-N-----------------------+                          
                      |                                                            |       |                                              +-------------------OBJ:V-N-------------------+        |                          
                      |                                                            |       |                                              |         +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
                      |                                                            |       |                              +--MOD_ATT:N-N--+         +--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
               +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             |       +MOD_ATT+         +COMP:N-N(of)+               |      |        |          |    +MOD_A+    
               |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,complex)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,fragment)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,complex)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 24 
                      +-------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------+                          
                      |                                                            +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                      |                                                            |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                      |                                                            |       |                                      +---------------------------SUBJ:V-N---------------------------+                          
                      |                                                            |       |                                      +-----------------------OBJ:V-N-----------------------+        |                          
                      |                                                            |       |                                      |                 +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
                      |                                                            |       |                                      |                 +--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
               +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             +MOD_ATT+       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
               |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,fragment)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 25 
                      +-------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------+                          
                      |                                                            +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                      |                                                            |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                      |                                                            |       |                                      +---------------------------SUBJ:V-N---------------------------+                          
                      |                                                            |       |                                      +-----------------------OBJ:V-N-----------------------+        |                          
                      |                                                            |       |                                      |                 +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
                      |                                                            |       |                                      |                 +--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
               +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             +MOD_ATT+       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
               |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,fragment)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 26 
                      +-------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------+                          
                      |                                                            +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                      |                                                            |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                      |                                                            |       |                                      +---------------------------SUBJ:V-N---------------------------+                          
                      |                                                            |       |                                      +-----------------------OBJ:V-N-----------------------+        |                          
                      |                                                            |       |                                      |                 +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
                      |                                                            |       |                                      |                 +--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
               +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             +MOD_ATT+       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
               |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,fragment)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 27 
                      +-------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------+                          
                      |                                                            +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                      |                                                            |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                      |                                                            |       |                                      +---------------------------SUBJ:V-N---------------------------+                          
                      |                                                            |       |                                      +-----------------------OBJ:V-N-----------------------+        |                          
                      |                                                            |       |                                      |                 +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
                      |                                                            |       |                                      |                 +--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
               +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             +MOD_ATT+       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
               |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,fragment)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 28 
                      +-------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------+                          
                      |                                                            +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                      |                                                            |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                      |                                                            |       |                              +-------------------------------SUBJ:V-N-------------------------------+                          
                      |                                                            |       |                              +---------------------------OBJ:V-N---------------------------+        |                          
                      |                                                            |       |                              |                         +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
                      |                                                            |       |                              |       +---MOD_ATT:N-N---+--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
               +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             |       |       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
               |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,fragment)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 29 
                      +-------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------+                          
                      |                                                            +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                      |                                                            |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                      |                                                            |       |                                              +-----------------------SUBJ:V-N-----------------------+                          
                      |                                                            |       |                                              +-------------------OBJ:V-N-------------------+        |                          
                      |                                                            |       |                                              |         +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
                      |                                                            |       |                              +--MOD_ATT:N-N--+         +--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
               +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             |       +MOD_ATT+         +COMP:N-N(of)+               |      |        |          |    +MOD_A+    
               |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,complex)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,fragment)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,complex)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 30 
                      +-------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------+                          
                      |                                                            +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                      |                                                            |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                      |                                                            |       |                              +-------------------------------SUBJ:V-N-------------------------------+                          
                      |                                                            |       |                              +---------------------------OBJ:V-N---------------------------+        |                          
                      |                                                            |       |                              |                         +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
                      |                                                            |       |                              |       +---MOD_ATT:N-N---+--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
               +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             |       |       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
               |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,fragment)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 31 
                      +-------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------+                          
                      |                                                            +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                      |                                                            |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                      |                                                            |       |                                              +-----------------------SUBJ:V-N-----------------------+                          
                      |                                                            |       |                                              +-------------------OBJ:V-N-------------------+        |                          
                      |                                                            |       |                                              |         +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
                      |                                                            |       |                              +--MOD_ATT:N-N--+         +--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
               +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             |       +MOD_ATT+         +COMP:N-N(of)+               |      |        |          |    +MOD_A+    
               |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,complex)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,fragment)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,complex)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 32 
                                                                                   +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                                                                                   |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                                                                                   |       |                              +-------------------------------SUBJ:V-N-------------------------------+                          
                                                                                   |       |                              +---------------------------OBJ:V-N---------------------------+        |                          
                                                                                   |       |                              |                         +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
    +-----OBJ:V-N-----+                                                            |       |                              |       +---MOD_ATT:N-N---+--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
    |          +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             |       |       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
    |          |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 33 
                                                                                   +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                                                                                   |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                                                                                   |       |                              +-------------------------------SUBJ:V-N-------------------------------+                          
                                                                                   |       |                              +---------------------------OBJ:V-N---------------------------+        |                          
                                                                                   |       |                              |                         +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
    +-----OBJ:V-N-----+                                                            |       |                              |       +---MOD_ATT:N-N---+--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
    |          +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             |       |       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
    |          |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 34 
                      +-------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------+                          
                      |                                                            +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                      |                                                            |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                      |                                                            |       |                                      +---------------------------SUBJ:V-N---------------------------+                          
                      |                                                            |       |                                      +-----------------------OBJ:V-N-----------------------+        |                          
                      |                                                            |       |                                      |                 +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
                      |                                                            |       |                                      |                 +--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
               +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             +MOD_ATT+       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
               |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,fragment)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 35 
                      +-------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------+                          
                      |                                                            +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                      |                                                            |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                      |                                                            |       |                                      +---------------------------SUBJ:V-N---------------------------+                          
                      |                                                            |       |                                      +-----------------------OBJ:V-N-----------------------+        |                          
                      |                                                            |       |                                      |                 +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
                      |                                                            |       |                                      |                 +--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
               +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             +MOD_ATT+       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
               |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,fragment)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 36 
                      +-------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------+                          
                      |                                                            +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                      |                                                            |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                      |                                                            |       |                                      +---------------------------SUBJ:V-N---------------------------+                          
                      |                                                            |       |                                      +-----------------------OBJ:V-N-----------------------+        |                          
                      |                                                            |       |                                      |                 +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
                      |                                                            |       |                                      |                 +--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
               +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             +MOD_ATT+       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
               |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,fragment)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 37 
                      +-------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------+                          
                      |                                                            +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                      |                                                            |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                      |                                                            |       |                                      +---------------------------SUBJ:V-N---------------------------+                          
                      |                                                            |       |                                      +-----------------------OBJ:V-N-----------------------+        |                          
                      |                                                            |       |                                      |                 +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
                      |                                                            |       |                                      |                 +--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
               +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             +MOD_ATT+       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
               |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,fragment)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 38 
                      +-------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------+                          
                      |                                                            +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                      |                                                            |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                      |                                                            |       |                              +-------------------------------SUBJ:V-N-------------------------------+                          
                      |                                                            |       |                              +---------------------------OBJ:V-N---------------------------+        |                          
                      |                                                            |       |                              |                         +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
                      |                                                            |       |                              |       +---MOD_ATT:N-N---+--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
               +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             |       |       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
               |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,fragment)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 39 
                      +-------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------+                          
                      |                                                            +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                      |                                                            |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                      |                                                            |       |                                              +-----------------------SUBJ:V-N-----------------------+                          
                      |                                                            |       |                                              +-------------------OBJ:V-N-------------------+        |                          
                      |                                                            |       |                                              |         +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
                      |                                                            |       |                              +--MOD_ATT:N-N--+         +--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
               +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             |       +MOD_ATT+         +COMP:N-N(of)+               |      |        |          |    +MOD_A+    
               |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,complex)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,fragment)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,complex)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 40 
                      +-------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------+                          
                      |                                                            +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                      |                                                            |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                      |                                                            |       |                              +-------------------------------SUBJ:V-N-------------------------------+                          
                      |                                                            |       |                              +---------------------------OBJ:V-N---------------------------+        |                          
                      |                                                            |       |                              |                         +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
                      |                                                            |       |                              |       +---MOD_ATT:N-N---+--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
               +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             |       |       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
               |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,fragment)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 41 
                      +-------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------+                          
                      |                                                            +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                      |                                                            |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                      |                                                            |       |                                              +-----------------------SUBJ:V-N-----------------------+                          
                      |                                                            |       |                                              +-------------------OBJ:V-N-------------------+        |                          
                      |                                                            |       |                                              |         +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
                      |                                                            |       |                              +--MOD_ATT:N-N--+         +--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
               +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             |       +MOD_ATT+         +COMP:N-N(of)+               |      |        |          |    +MOD_A+    
               |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,complex)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,fragment)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,complex)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 42 
                      +-------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------+                          
                      |                                                            +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                      |                                                            |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                      |                                                            |       |                                      +---------------------------SUBJ:V-N---------------------------+                          
                      |                                                            |       |                                      +-----------------------OBJ:V-N-----------------------+        |                          
                      |                                                            |       |                                      |                 +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
                      |                                                            |       |                                      |                 +--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
               +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             +MOD_ATT+       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
               |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,fragment)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 43 
                      +-------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------+                          
                      |                                                            +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                      |                                                            |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                      |                                                            |       |                                      +---------------------------SUBJ:V-N---------------------------+                          
                      |                                                            |       |                                      +-----------------------OBJ:V-N-----------------------+        |                          
                      |                                                            |       |                                      |                 +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
                      |                                                            |       |                                      |                 +--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
               +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             +MOD_ATT+       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
               |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,fragment)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 44 
                      +-------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------+                          
                      |                                                            +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                      |                                                            |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                      |                                                            |       |                                      +---------------------------SUBJ:V-N---------------------------+                          
                      |                                                            |       |                                      +-----------------------OBJ:V-N-----------------------+        |                          
                      |                                                            |       |                                      |                 +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
                      |                                                            |       |                                      |                 +--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
               +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             +MOD_ATT+       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
               |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,fragment)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 45 
                      +-------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------+                          
                      |                                                            +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                      |                                                            |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                      |                                                            |       |                                      +---------------------------SUBJ:V-N---------------------------+                          
                      |                                                            |       |                                      +-----------------------OBJ:V-N-----------------------+        |                          
                      |                                                            |       |                                      |                 +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
                      |                                                            |       |                                      |                 +--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
               +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             +MOD_ATT+       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
               |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,fragment)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 46 
                      +-------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------+                          
                      |                                                            +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                      |                                                            |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                      |                                                            |       |                              +-------------------------------SUBJ:V-N-------------------------------+                          
                      |                                                            |       |                              +---------------------------OBJ:V-N---------------------------+        |                          
                      |                                                            |       |                              |                         +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
                      |                                                            |       |                              |       +---MOD_ATT:N-N---+--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
               +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             |       |       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
               |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,fragment)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 47 
                      +-------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------+                          
                      |                                                            +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                      |                                                            |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                      |                                                            |       |                                              +-----------------------SUBJ:V-N-----------------------+                          
                      |                                                            |       |                                              +-------------------OBJ:V-N-------------------+        |                          
                      |                                                            |       |                                              |         +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
                      |                                                            |       |                              +--MOD_ATT:N-N--+         +--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
               +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             |       +MOD_ATT+         +COMP:N-N(of)+               |      |        |          |    +MOD_A+    
               |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,complex)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,fragment)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,complex)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 48 
                      +-------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------+                          
                      |                                                            +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                      |                                                            |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                      |                                                            |       |                              +-------------------------------SUBJ:V-N-------------------------------+                          
                      |                                                            |       |                              +---------------------------OBJ:V-N---------------------------+        |                          
                      |                                                            |       |                              |                         +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
                      |                                                            |       |                              |       +---MOD_ATT:N-N---+--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
               +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             |       |       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
               |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,fragment)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 49 
                      +-------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------+                          
                      |                                                            +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                      |                                                            |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                      |                                                            |       |                                              +-----------------------SUBJ:V-N-----------------------+                          
                      |                                                            |       |                                              +-------------------OBJ:V-N-------------------+        |                          
                      |                                                            |       |                                              |         +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
                      |                                                            |       |                              +--MOD_ATT:N-N--+         +--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
               +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             |       +MOD_ATT+         +COMP:N-N(of)+               |      |        |          |    +MOD_A+    
               |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,complex)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,fragment)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,complex)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 50 
                                                                                   +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                                                                                   |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                                                                                   |       |                              +-------------------------------SUBJ:V-N-------------------------------+                          
                                                                                   |       |                              +---------------------------OBJ:V-N---------------------------+        |                          
                                                                                   |       |                              |                         +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
    +-----OBJ:V-N-----+                                                            |       |                              |       +---MOD_ATT:N-N---+--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
    |          +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             |       |       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
    |          |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 51 
                                                                                   +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                                                                                   |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                                                                                   |       |                              +-------------------------------SUBJ:V-N-------------------------------+                          
                                                                                   |       |                              +---------------------------OBJ:V-N---------------------------+        |                          
                                                                                   |       |                              |                         +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
    +-----OBJ:V-N-----+                                                            |       |                              |       +---MOD_ATT:N-N---+--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
    |          +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             |       |       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
    |          |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 52 
                      +-------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------+                          
                      |                                                            +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                      |                                                            |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                      |                                                            |       |                              +-------------------------------SUBJ:V-N-------------------------------+                          
                      |                                                            |       |                              +---------------------------OBJ:V-N---------------------------+        |                          
                      |                                                            |       |                              |                         +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
                      |                                                            |       |                              |       +---MOD_ATT:N-N---+--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
               +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             |       |       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
               |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,fragment)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 53 
                      +-------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------+                          
                      |                                                            +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                      |                                                            |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                      |                                                            |       |                              +-------------------------------SUBJ:V-N-------------------------------+                          
                      |                                                            |       |                              +---------------------------OBJ:V-N---------------------------+        |                          
                      |                                                            |       |                              |                         +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
                      |                                                            |       |                              |       +---MOD_ATT:N-N---+--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
               +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             |       |       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
               |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,fragment)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 54 
                      +-------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------+                          
                      |                                                            +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                      |                                                            |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                      |                                                            |       |                              +-------------------------------SUBJ:V-N-------------------------------+                          
                      |                                                            |       |                              +---------------------------OBJ:V-N---------------------------+        |                          
                      |                                                            |       |                              |                         +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
                      |                                                            |       |                              |       +---MOD_ATT:N-N---+--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
               +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             |       |       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
               |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,fragment)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 55 
                      +-------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------+                          
                      |                                                            +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                      |                                                            |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                      |                                                            |       |                              +-------------------------------SUBJ:V-N-------------------------------+                          
                      |                                                            |       |                              +---------------------------OBJ:V-N---------------------------+        |                          
                      |                                                            |       |                              |                         +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
                      |                                                            |       |                              |       +---MOD_ATT:N-N---+--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
               +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             |       |       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
               |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,fragment)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 56 
                      +-------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------+                          
                      |                                                            +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                      |                                                            |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                      |                                                            |       |                              +-------------------------------SUBJ:V-N-------------------------------+                          
                      |                                                            |       |                              +---------------------------OBJ:V-N---------------------------+        |                          
                      |                                                            |       |                              |                         +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
                      |                                                            |       |                              |       +---MOD_ATT:N-N---+--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
               +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             |       |       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
               |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,fragment)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 57 
                      +-------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------+                          
                      |                                                            +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                      |                                                            |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                      |                                                            |       |                              +-------------------------------SUBJ:V-N-------------------------------+                          
                      |                                                            |       |                              +---------------------------OBJ:V-N---------------------------+        |                          
                      |                                                            |       |                              |                         +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
                      |                                                            |       |                              |       +---MOD_ATT:N-N---+--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
               +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             |       |       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
               |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,fragment)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 58 
                      +-------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------+                          
                      |                                                            +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                      |                                                            |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                      |                                                            |       |                              +-------------------------------SUBJ:V-N-------------------------------+                          
                      |                                                            |       |                              +---------------------------OBJ:V-N---------------------------+        |                          
                      |                                                            |       |                              |                         +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
                      |                                                            |       |                              |       +---MOD_ATT:N-N---+--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
               +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             |       |       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
               |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,fragment)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
Analyse 59 
                      +-------------------------------------------------------------------------------COMP:V-N(of)-------------------------------------------------------------------------------+                          
                      |                                                            +------------------------------------------------COMP:V-N(from)-----------------------------------------------+                          
                      |                                                            |       +-----------------------------------------------SUBJ:V-N----------------------------------------------+                          
                      |                                                            |       |                              +-------------------------------SUBJ:V-N-------------------------------+                          
                      |                                                            |       |                              +---------------------------OBJ:V-N---------------------------+        |                          
                      |                                                            |       |                              |                         +--------------SUBJ:V-N-------------+        +-----COMP:V-N(in)----+    
                      |                                                            |       |                              |       +---MOD_ATT:N-N---+--------COMP:N-N(of)--------+      |        |          +MOD_ATT:N-+    
               +MOD_AT+----------APPOS---------+                            +MOD_AT+       +------APPOS-----+             |       |       +MOD_ATT:N+COMP:N-N(of)+               |      |        |          |    +MOD_A+    
               |      |                        |                            |      |       |                |             |       |       |         |            |               |      |        |          |    |     |    
 Binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGATTTAATATC ) from mutant __SP__ __NODE__ gene ( G?T G?T ) and a protein protein complex consisting of __NODE__ and of __NODE__ does not occur in a cell free system .
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGATTTAATATC)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G?T)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,fragment)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)