Validation pour Ingenuity061

vers la météo de la validation par utilisateur

Ingenuity061

precedent - 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 - suivant

Phrase 49 - PMID ?

Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant SP NODE gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of SP NODE and of NODE does not occur in a system of purified components .

Non annotée
Je ne sais pas
Je n'ai pas trouvé d'analyse satisfaisante

Commentaires :

Analyse 0

                                                                               +-------------------------------------------------------COMP:V-N(from)------------------------------------------------------+                                                
                                                                               +-------------------------------------------COMP:V-N(from)-------------------------------------------+                      |                                                
                                                                               |       +------------------------------------------SUBJ:V-N------------------------------------------+                      |                                                
                                                                               +---------------------------------COMP:V-N(from)---------------------------------+                   |                      |                                                
    +---------------OBJ:V-N---------------+                                    |       |                                              +--MOD_ATT:N-N--+-----------SUBJ:V-N----------+               +----SUBJ:V-N---+           +----COMP:N-N(of)----+      
    |           +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+-SUBJ:V-N+COMP:N-N(of+       |               |      |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |           |        |                |                             |      |       |                               |              |       |       |         |           |       |               |      |   |    |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,CTCAGAACATAAAGAACAGAG)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:V-N(from) (consist,__SP__)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__SP__)
COMP:V-N(from) (__NODE__,__SP__)
SUBJ:V-N (__NODE__,__NODE__)
SUBJ:V-N (__NODE__,complex)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 1

                                                                               +-------------------------------------------------------COMP:V-N(from)------------------------------------------------------+                                                
                                                                               +-------------------------------------------COMP:V-N(from)-------------------------------------------+                      |                                                
                                                                               |       +------------------------------------------SUBJ:V-N------------------------------------------+                      |                                                
                                                                               +---------------------------------COMP:V-N(from)---------------------------------+                   |                      |                                                
    +---------------OBJ:V-N---------------+                                    |       |                                              +--MOD_ATT:N-N--+-----------SUBJ:V-N----------+               +----SUBJ:V-N---+           +----COMP:N-N(of)----+      
    |           +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+-SUBJ:V-N+COMP:N-N(of+       |               |      |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |           |        |                |                             |      |       |                               |              |       |       |         |           |       |               |      |   |    |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,CTCAGAACATAAAGAACAGAG)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:V-N(from) (consist,__SP__)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__SP__)
COMP:V-N(from) (__NODE__,__SP__)
SUBJ:V-N (__NODE__,__NODE__)
SUBJ:V-N (__NODE__,complex)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 2

                                                                               +-------------------------------------------COMP:V-N(from)-------------------------------------------+                                                                       
                                                                               |       +------------------------------------------SUBJ:V-N------------------------------------------+                                                                       
                                                                               +---------------------------------COMP:V-N(from)---------------------------------+                   |                                                                       
    +---------------OBJ:V-N---------------+                                    |       |                                              +--MOD_ATT:N-N--+-----------SUBJ:V-N----------+               +----SUBJ:V-N---+           +----COMP:N-N(of)----+      
    |           +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+-SUBJ:V-N+COMP:N-N(of+       |               |          +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |           |        |                |                             |      |       |                               |              |       |       |         |           |       |               |          |    |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,CTCAGAACATAAAGAACAGAG)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:V-N(from) (consist,__SP__)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__SP__)
COMP:V-N(from) (__NODE__,__SP__)
SUBJ:V-N (__NODE__,__NODE__)
SUBJ:V-N (__NODE__,complex)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 3

                                                                               +-------------------------------------------COMP:V-N(from)-------------------------------------------+                                                                       
                                                                               |       +------------------------------------------SUBJ:V-N------------------------------------------+                                                                       
                                                                               +---------------------------------COMP:V-N(from)---------------------------------+                   |                                                                       
    +---------------OBJ:V-N---------------+                                    |       |                                              +--MOD_ATT:N-N--+-----------SUBJ:V-N----------+               +----SUBJ:V-N---+           +----COMP:N-N(of)----+      
    |           +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+-SUBJ:V-N+COMP:N-N(of+       |               |          +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |           |        |                |                             |      |       |                               |              |       |       |         |           |       |               |          |    |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,CTCAGAACATAAAGAACAGAG)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:V-N(from) (consist,__SP__)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__SP__)
COMP:V-N(from) (__NODE__,__SP__)
SUBJ:V-N (__NODE__,__NODE__)
SUBJ:V-N (__NODE__,complex)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 4

                                                                               +-------------------------------------------COMP:V-N(from)-------------------------------------------+                                                                       
                                                                               |       +------------------------------------------SUBJ:V-N------------------------------------------+                                                                       
                                                                               +---------------------------------COMP:V-N(from)---------------------------------+                   |                                                                       
    +---------------OBJ:V-N---------------+                                    |       |                                              +--MOD_ATT:N-N--+-----------SUBJ:V-N----------+               +----SUBJ:V-N---+           +----COMP:N-N(of)----+      
    |           +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+-SUBJ:V-N+COMP:N-N(of+       |               |          +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |           |        |                |                             |      |       |                               |              |       |       |         |           |       |               |          |    |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,CTCAGAACATAAAGAACAGAG)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:V-N(from) (consist,__SP__)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__SP__)
COMP:V-N(from) (__NODE__,__SP__)
SUBJ:V-N (__NODE__,__NODE__)
SUBJ:V-N (__NODE__,complex)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 5

                                                                               +-------------------------------------------------------COMP:V-N(from)------------------------------------------------------+                                                
                                                                               +-------------------------------------------COMP:V-N(from)-------------------------------------------+                      |                                                
                                                                               |       +------------------------------------------SUBJ:V-N------------------------------------------+                      |                                                
                                                                               +---------------------------------COMP:V-N(from)---------------------------------+                   |                      |                                                
                                                                               |       |                                              +--MOD_ATT:N-N--+-----------SUBJ:V-N----------+               +----SUBJ:V-N---+           +----COMP:N-N(of)----+      
    +------------------------OBJ:V-N-----------------------+            +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+-SUBJ:V-N+COMP:N-N(of+       |               |      |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |                                                      |            |      |       |                               |              |       |       |         |           |       |               |      |   |    |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:V-N(from) (consist,__SP__)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__SP__)
COMP:V-N(from) (__NODE__,__SP__)
SUBJ:V-N (__NODE__,__NODE__)
SUBJ:V-N (__NODE__,complex)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 6

                                                                               +-------------------------------------------COMP:V-N(from)-------------------------------------------+                                                                       
                                                                               |       +------------------------------------------SUBJ:V-N------------------------------------------+                                                                       
    +---------------OBJ:V-N---------------+                                    |       |                                              +--MOD_ATT:N-N--+-----------SUBJ:V-N----------+               +----SUBJ:V-N---+           +----COMP:N-N(of)----+      
    |           +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+-SUBJ:V-N+COMP:N-N(of+       |               |          +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |           |        |                |                             |      |       |                               |              |       |       |         |           |       |               |          |    |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,CTCAGAACATAAAGAACAGAG)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__SP__)
COMP:V-N(from) (__NODE__,__SP__)
SUBJ:V-N (__NODE__,__NODE__)
SUBJ:V-N (__NODE__,complex)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 7

                                                                               +-------------------------------------------COMP:V-N(from)-------------------------------------------+                                                                       
                                                                               |       +------------------------------------------SUBJ:V-N------------------------------------------+                                                                       
    +---------------OBJ:V-N---------------+                                    |       |                                              +--MOD_ATT:N-N--+-----------SUBJ:V-N----------+               +----SUBJ:V-N---+           +----COMP:N-N(of)----+      
    |           +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+-SUBJ:V-N+COMP:N-N(of+       |               |          +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |           |        |                |                             |      |       |                               |              |       |       |         |           |       |               |          |    |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,CTCAGAACATAAAGAACAGAG)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__SP__)
COMP:V-N(from) (__NODE__,__SP__)
SUBJ:V-N (__NODE__,__NODE__)
SUBJ:V-N (__NODE__,complex)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 8

                                                                               +-------------------------------------------COMP:V-N(from)-------------------------------------------+                                                                       
                                                                               |       +------------------------------------------SUBJ:V-N------------------------------------------+                                                                       
    +---------------OBJ:V-N---------------+                                    |       |                                              +--MOD_ATT:N-N--+-----------SUBJ:V-N----------+               +----SUBJ:V-N---+           +----COMP:N-N(of)----+      
    |           +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+-SUBJ:V-N+COMP:N-N(of+       |               |          +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |           |        |                |                             |      |       |                               |              |       |       |         |           |       |               |          |    |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,CTCAGAACATAAAGAACAGAG)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__SP__)
COMP:V-N(from) (__NODE__,__SP__)
SUBJ:V-N (__NODE__,__NODE__)
SUBJ:V-N (__NODE__,complex)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 9

                                                                               +-------------------------------------------COMP:V-N(from)-------------------------------------------+                                                                       
                                                                               |       +------------------------------------------SUBJ:V-N------------------------------------------+                                                                       
                                                                               +---------------------------------COMP:V-N(from)---------------------------------+                   |                                                                       
                                                                               |       |                                              +--MOD_ATT:N-N--+-----------SUBJ:V-N----------+               +----SUBJ:V-N---+           +----COMP:N-N(of)----+      
    +------------------------OBJ:V-N-----------------------+            +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+-SUBJ:V-N+COMP:N-N(of+       |               |          +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |                                                      |            |      |       |                               |              |       |       |         |           |       |               |          |    |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:V-N(from) (consist,__SP__)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__SP__)
COMP:V-N(from) (__NODE__,__SP__)
SUBJ:V-N (__NODE__,__NODE__)
SUBJ:V-N (__NODE__,complex)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 10

                                                                               +-------------------------------------------COMP:V-N(from)-------------------------------------------+                                                                       
                                                                               |       +------------------------------------------SUBJ:V-N------------------------------------------+                                                                       
                                                                               |       |                                              +--MOD_ATT:N-N--+-----------SUBJ:V-N----------+               +----SUBJ:V-N---+           +----COMP:N-N(of)----+      
    +------------------------OBJ:V-N-----------------------+            +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+-SUBJ:V-N+COMP:N-N(of+       |               |          +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |                                                      |            |      |       |                               |              |       |       |         |           |       |               |          |    |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__SP__)
COMP:V-N(from) (__NODE__,__SP__)
SUBJ:V-N (__NODE__,__NODE__)
SUBJ:V-N (__NODE__,complex)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 11

                                                                               +-------------------------------------------COMP:V-N(from)-------------------------------------------+                                                                       
                                                                               |       +------------------------------------------SUBJ:V-N------------------------------------------+                                                                       
                                                                               |       |                                              +--MOD_ATT:N-N--+-----------SUBJ:V-N----------+               +----SUBJ:V-N---+           +----COMP:N-N(of)----+      
    +------------------------OBJ:V-N-----------------------+            +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+-SUBJ:V-N+COMP:N-N(of+       |               |          +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |                                                      |            |      |       |                               |              |       |       |         |           |       |               |          |    |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__SP__)
COMP:V-N(from) (__NODE__,__SP__)
SUBJ:V-N (__NODE__,__NODE__)
SUBJ:V-N (__NODE__,complex)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 12

                                                                               +-------------------------------------------COMP:V-N(from)-------------------------------------------+                                                                       
                                                                               |       +------------------------------------------SUBJ:V-N------------------------------------------+                                                                       
                                                                               +---------------------------------COMP:V-N(from)---------------------------------+                   |                                                                       
                                                                               |       |                                              +--MOD_ATT:N-N--+-----------SUBJ:V-N----------+               +----SUBJ:V-N---+           +----COMP:N-N(of)----+      
    +------------------------OBJ:V-N-----------------------+            +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+-SUBJ:V-N+COMP:N-N(of+       |               |          +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |                                                      |            |      |       |                               |              |       |       |         |           |       |               |          |    |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:V-N(from) (consist,__SP__)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__SP__)
COMP:V-N(from) (__NODE__,__SP__)
SUBJ:V-N (__NODE__,__NODE__)
SUBJ:V-N (__NODE__,complex)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 13

                                                                               +-------------------------------------------COMP:V-N(from)-------------------------------------------+                                                                       
                                                                               |       +------------------------------------------SUBJ:V-N------------------------------------------+                                                                       
                                                                               +---------------------------------COMP:V-N(from)---------------------------------+                   |                                                                       
                                                                               |       |                                              +--MOD_ATT:N-N--+-----------SUBJ:V-N----------+               +----SUBJ:V-N---+           +----COMP:N-N(of)----+      
    +------------------------OBJ:V-N-----------------------+            +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+-SUBJ:V-N+COMP:N-N(of+       |               |          +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |                                                      |            |      |       |                               |              |       |       |         |           |       |               |          |    |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:V-N(from) (consist,__SP__)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__SP__)
COMP:V-N(from) (__NODE__,__SP__)
SUBJ:V-N (__NODE__,__NODE__)
SUBJ:V-N (__NODE__,complex)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 14

                                          +--------------------------------------------------------------------------COMP:V-N(of)--------------------------------------------------------------------------+                                                
                                          +---------------------------------------------------------------COMP:V-N(of)--------------------------------------------------------------+                      |                                                
                                          |                                    +-------------------------------------------------------COMP:V-N(from)------------------------------------------------------+                                                
                                          +-----------------------------------------------------COMP:V-N(of)----------------------------------------------------+                   |                      |                                                
                                          |                                    +-------------------------------------------COMP:V-N(from)-------------------------------------------+                      |                                                
                                          |                                    |       +------------------------------------------SUBJ:V-N------------------------------------------+                      |                                                
                                          |                                    +---------------------------------COMP:V-N(from)---------------------------------+                   |                      |                                                
                                          |                                    |       |                                              +--MOD_ATT:N-N--+-----------SUBJ:V-N----------+               +----SUBJ:V-N---+           +----COMP:N-N(of)----+      
                +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+-SUBJ:V-N+COMP:N-N(of+       |               |      |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
                |        |                |                             |      |       |                               |              |       |       |         |           |       |               |      |   |    |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:V-N(of) (consist,CTCAGAACATAAAGAACAGAG)
COMP:V-N(from) (consist,__SP__)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__SP__)
COMP:V-N(of) (__NODE__,CTCAGAACATAAAGAACAGAG)
COMP:V-N(from) (__NODE__,__SP__)
SUBJ:V-N (__NODE__,__NODE__)
SUBJ:V-N (__NODE__,complex)
COMP:V-N(of) (do,CTCAGAACATAAAGAACAGAG)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 15

                                                                               +-------------------------------------------COMP:V-N(from)-------------------------------------------+                                                                       
                                                                               |       +------------------------------------------SUBJ:V-N------------------------------------------+                                                                       
                                                                               |       |                                              +--MOD_ATT:N-N--+-----------SUBJ:V-N----------+               +----SUBJ:V-N---+           +----COMP:N-N(of)----+      
    +------------------------OBJ:V-N-----------------------+            +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+-SUBJ:V-N+COMP:N-N(of+       |               |          +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
    |                                                      |            |      |       |                               |              |       |       |         |           |       |               |          |    |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__SP__)
COMP:V-N(from) (__NODE__,__SP__)
SUBJ:V-N (__NODE__,__NODE__)
SUBJ:V-N (__NODE__,complex)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 16

                                          +---------------------------------------------------------------COMP:V-N(of)--------------------------------------------------------------+                                                                       
                                          +-----------------------------------------------------COMP:V-N(of)----------------------------------------------------+                   |                                                                       
                                          |                                    +-------------------------------------------COMP:V-N(from)-------------------------------------------+                                                                       
                                          |                                    |       +------------------------------------------SUBJ:V-N------------------------------------------+                                                                       
                                          |                                    +---------------------------------COMP:V-N(from)---------------------------------+                   |                                                                       
                                          |                                    |       |                                              +--MOD_ATT:N-N--+-----------SUBJ:V-N----------+               +----SUBJ:V-N---+           +----COMP:N-N(of)----+      
                +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+-SUBJ:V-N+COMP:N-N(of+       |               |          +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
                |        |                |                             |      |       |                               |              |       |       |         |           |       |               |          |    |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:V-N(of) (consist,CTCAGAACATAAAGAACAGAG)
COMP:V-N(from) (consist,__SP__)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__SP__)
COMP:V-N(of) (__NODE__,CTCAGAACATAAAGAACAGAG)
COMP:V-N(from) (__NODE__,__SP__)
SUBJ:V-N (__NODE__,__NODE__)
SUBJ:V-N (__NODE__,complex)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 17

                                          +---------------------------------------------------------------COMP:V-N(of)--------------------------------------------------------------+                                                                       
                                          |                                    +-------------------------------------------COMP:V-N(from)-------------------------------------------+                                                                       
                                          |                                    |       +------------------------------------------SUBJ:V-N------------------------------------------+                                                                       
                                          |                                    |       |                                              +--MOD_ATT:N-N--+-----------SUBJ:V-N----------+               +----SUBJ:V-N---+           +----COMP:N-N(of)----+      
                +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+-SUBJ:V-N+COMP:N-N(of+       |               |          +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
                |        |                |                             |      |       |                               |              |       |       |         |           |       |               |          |    |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__SP__)
COMP:V-N(of) (__NODE__,CTCAGAACATAAAGAACAGAG)
COMP:V-N(from) (__NODE__,__SP__)
SUBJ:V-N (__NODE__,__NODE__)
SUBJ:V-N (__NODE__,complex)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 18

                                          +---------------------------------------------------------------COMP:V-N(of)--------------------------------------------------------------+                                                                       
                                          |                                    +-------------------------------------------COMP:V-N(from)-------------------------------------------+                                                                       
                                          |                                    |       +------------------------------------------SUBJ:V-N------------------------------------------+                                                                       
                                          |                                    |       |                                              +--MOD_ATT:N-N--+-----------SUBJ:V-N----------+               +----SUBJ:V-N---+           +----COMP:N-N(of)----+      
                +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+-SUBJ:V-N+COMP:N-N(of+       |               |          +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
                |        |                |                             |      |       |                               |              |       |       |         |           |       |               |          |    |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__SP__)
COMP:V-N(of) (__NODE__,CTCAGAACATAAAGAACAGAG)
COMP:V-N(from) (__NODE__,__SP__)
SUBJ:V-N (__NODE__,__NODE__)
SUBJ:V-N (__NODE__,complex)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 19

                                                           +------------------------------------------------------------------COMP:V-N(of)-----------------------------------------------------------------+                                                
                                                           |                   +-------------------------------------------------------COMP:V-N(from)------------------------------------------------------+                                                
                                                           +------------------------------------------------------COMP:V-N(of)------------------------------------------------------+                      |                                                
                                                           +--------------------------------------------COMP:V-N(of)--------------------------------------------+                   |                      |                                                
                                                           |                   +-------------------------------------------COMP:V-N(from)-------------------------------------------+                      |                                                
                                                           |                   |       +------------------------------------------SUBJ:V-N------------------------------------------+                      |                                                
                                                           |                   +---------------------------------COMP:V-N(from)---------------------------------+                   |                      |                                                
                                                           |                   |       |                                              +--MOD_ATT:N-N--+-----------SUBJ:V-N----------+               +----SUBJ:V-N---+           +----COMP:N-N(of)----+      
                                                           |            +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+-SUBJ:V-N+COMP:N-N(of+       |               |      |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
                                                           |            |      |       |                               |              |       |       |         |           |       |               |      |   |    |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:V-N(of) (consist,@card@)
COMP:V-N(from) (consist,__SP__)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__SP__)
COMP:V-N(of) (__NODE__,@card@)
COMP:V-N(from) (__NODE__,__SP__)
SUBJ:V-N (__NODE__,__NODE__)
SUBJ:V-N (__NODE__,complex)
COMP:V-N(of) (do,@card@)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 20

                                                           +------------------------------------------------------------------COMP:V-N(of)-----------------------------------------------------------------+                                                
                                                           |                   +-------------------------------------------------------COMP:V-N(from)------------------------------------------------------+                                                
                                                           +------------------------------------------------------COMP:V-N(of)------------------------------------------------------+                      |                                                
                                                           +--------------------------------------------COMP:V-N(of)--------------------------------------------+                   |                      |                                                
                                                           |                   +-------------------------------------------COMP:V-N(from)-------------------------------------------+                      |                                                
                                                           |                   |       +------------------------------------------SUBJ:V-N------------------------------------------+                      |                                                
                                                           |                   +---------------------------------COMP:V-N(from)---------------------------------+                   |                      |                                                
                                                           |                   |       |                                              +--MOD_ATT:N-N--+-----------SUBJ:V-N----------+               +----SUBJ:V-N---+           +----COMP:N-N(of)----+      
                                                           |            +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+-SUBJ:V-N+COMP:N-N(of+       |               |      |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
                                                           |            |      |       |                               |              |       |       |         |           |       |               |      |   |    |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:V-N(of) (consist,@card@)
COMP:V-N(from) (consist,__SP__)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__SP__)
COMP:V-N(of) (__NODE__,@card@)
COMP:V-N(from) (__NODE__,__SP__)
SUBJ:V-N (__NODE__,__NODE__)
SUBJ:V-N (__NODE__,complex)
COMP:V-N(of) (do,@card@)
COMP:V-N(from) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 21

                                                           +------------------------------------------------------COMP:V-N(of)------------------------------------------------------+                                                                       
                                                           +--------------------------------------------COMP:V-N(of)--------------------------------------------+                   |                                                                       
                                                           |                   +-------------------------------------------COMP:V-N(from)-------------------------------------------+                                                                       
                                                           |                   |       +------------------------------------------SUBJ:V-N------------------------------------------+                                                                       
                                                           |                   +---------------------------------COMP:V-N(from)---------------------------------+                   |                                                                       
                                                           |                   |       |                                              +--MOD_ATT:N-N--+-----------SUBJ:V-N----------+               +----SUBJ:V-N---+           +----COMP:N-N(of)----+      
                                                           |            +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+-SUBJ:V-N+COMP:N-N(of+       |               |          +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
                                                           |            |      |       |                               |              |       |       |         |           |       |               |          |    |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:V-N(of) (consist,@card@)
COMP:V-N(from) (consist,__SP__)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__SP__)
COMP:V-N(of) (__NODE__,@card@)
COMP:V-N(from) (__NODE__,__SP__)
SUBJ:V-N (__NODE__,__NODE__)
SUBJ:V-N (__NODE__,complex)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 22

                                                           +------------------------------------------------------COMP:V-N(of)------------------------------------------------------+                                                                       
                                                           +--------------------------------------------COMP:V-N(of)--------------------------------------------+                   |                                                                       
                                                           |                   +-------------------------------------------COMP:V-N(from)-------------------------------------------+                                                                       
                                                           |                   |       +------------------------------------------SUBJ:V-N------------------------------------------+                                                                       
                                                           |                   +---------------------------------COMP:V-N(from)---------------------------------+                   |                                                                       
                                                           |                   |       |                                              +--MOD_ATT:N-N--+-----------SUBJ:V-N----------+               +----SUBJ:V-N---+           +----COMP:N-N(of)----+      
                                                           |            +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+-SUBJ:V-N+COMP:N-N(of+       |               |          +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
                                                           |            |      |       |                               |              |       |       |         |           |       |               |          |    |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:V-N(of) (consist,@card@)
COMP:V-N(from) (consist,__SP__)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__SP__)
COMP:V-N(of) (__NODE__,@card@)
COMP:V-N(from) (__NODE__,__SP__)
SUBJ:V-N (__NODE__,__NODE__)
SUBJ:V-N (__NODE__,complex)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 23

                                                           +------------------------------------------------------COMP:V-N(of)------------------------------------------------------+                                                                       
                                                           +--------------------------------------------COMP:V-N(of)--------------------------------------------+                   |                                                                       
                                                           |                   +-------------------------------------------COMP:V-N(from)-------------------------------------------+                                                                       
                                                           |                   |       +------------------------------------------SUBJ:V-N------------------------------------------+                                                                       
                                                           |                   +---------------------------------COMP:V-N(from)---------------------------------+                   |                                                                       
                                                           |                   |       |                                              +--MOD_ATT:N-N--+-----------SUBJ:V-N----------+               +----SUBJ:V-N---+           +----COMP:N-N(of)----+      
                                                           |            +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+-SUBJ:V-N+COMP:N-N(of+       |               |          +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
                                                           |            |      |       |                               |              |       |       |         |           |       |               |          |    |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:V-N(of) (consist,@card@)
COMP:V-N(from) (consist,__SP__)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__SP__)
COMP:V-N(of) (__NODE__,@card@)
COMP:V-N(from) (__NODE__,__SP__)
SUBJ:V-N (__NODE__,__NODE__)
SUBJ:V-N (__NODE__,complex)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 24

                                                                               +--------------------------------------------------------COMP:V-N(of)-------------------------------------------------------+                                                
                                                                               +--------------------------------------------COMP:V-N(of)--------------------------------------------+                      |                                                
                +--------------------------MOD_ATT:N-N-------------------------+       +------------------------------------------SUBJ:V-N------------------------------------------+                      |                                                
                |        +---------------------MOD_ATT:N-N---------------------+----------------------------------COMP:V-N(of)----------------------------------+                   |                      |                                                
                |        |                                 +----MOD_ATT:N-N----+       |                                              +--MOD_ATT:N-N--+-----------SUBJ:V-N----------+               +----SUBJ:V-N---+           +----COMP:N-N(of)----+      
                |        |                                 |            +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+-SUBJ:V-N+COMP:N-N(of+       |               |      |   +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
                |        |                                 |            |      |       |                               |              |       |       |         |           |       |               |      |   |    |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (__SP__,promoter)
MOD_ATT:N-N (__SP__,fragment)
MOD_ATT:N-N (__SP__,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:V-N(of) (consist,__SP__)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__SP__)
COMP:V-N(of) (__NODE__,__SP__)
SUBJ:V-N (__NODE__,__NODE__)
SUBJ:V-N (__NODE__,complex)
COMP:V-N(of) (do,__SP__)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 25

                                                           +------------------------------------------------------COMP:V-N(of)------------------------------------------------------+                                                                       
                                                           |                   +-------------------------------------------COMP:V-N(from)-------------------------------------------+                                                                       
                                                           |                   |       +------------------------------------------SUBJ:V-N------------------------------------------+                                                                       
                                                           |                   |       |                                              +--MOD_ATT:N-N--+-----------SUBJ:V-N----------+               +----SUBJ:V-N---+           +----COMP:N-N(of)----+      
                                                           |            +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+-SUBJ:V-N+COMP:N-N(of+       |               |          +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
                                                           |            |      |       |                               |              |       |       |         |           |       |               |          |    |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__SP__)
COMP:V-N(of) (__NODE__,@card@)
COMP:V-N(from) (__NODE__,__SP__)
SUBJ:V-N (__NODE__,__NODE__)
SUBJ:V-N (__NODE__,complex)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 26

                                                           +------------------------------------------------------COMP:V-N(of)------------------------------------------------------+                                                                       
                                                           |                   +-------------------------------------------COMP:V-N(from)-------------------------------------------+                                                                       
                                                           |                   |       +------------------------------------------SUBJ:V-N------------------------------------------+                                                                       
                                                           |                   |       |                                              +--MOD_ATT:N-N--+-----------SUBJ:V-N----------+               +----SUBJ:V-N---+           +----COMP:N-N(of)----+      
                                                           |            +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+-SUBJ:V-N+COMP:N-N(of+       |               |          +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
                                                           |            |      |       |                               |              |       |       |         |           |       |               |          |    |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__SP__)
COMP:V-N(of) (__NODE__,@card@)
COMP:V-N(from) (__NODE__,__SP__)
SUBJ:V-N (__NODE__,__NODE__)
SUBJ:V-N (__NODE__,complex)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 27

                                                                               +--------------------------------------------COMP:V-N(of)--------------------------------------------+                                                                       
                +--------------------------MOD_ATT:N-N-------------------------+       +------------------------------------------SUBJ:V-N------------------------------------------+                                                                       
                |        +---------------------MOD_ATT:N-N---------------------+----------------------------------COMP:V-N(of)----------------------------------+                   |                                                                       
                |        |                                 +----MOD_ATT:N-N----+       |                                              +--MOD_ATT:N-N--+-----------SUBJ:V-N----------+               +----SUBJ:V-N---+           +----COMP:N-N(of)----+      
                |        |                                 |            +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+-SUBJ:V-N+COMP:N-N(of+       |               |          +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
                |        |                                 |            |      |       |                               |              |       |       |         |           |       |               |          |    |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (__SP__,promoter)
MOD_ATT:N-N (__SP__,fragment)
MOD_ATT:N-N (__SP__,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:V-N(of) (consist,__SP__)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__SP__)
COMP:V-N(of) (__NODE__,__SP__)
SUBJ:V-N (__NODE__,__NODE__)
SUBJ:V-N (__NODE__,complex)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 28

                                                                               +--------------------------------------------COMP:V-N(of)--------------------------------------------+                                                                       
                +--------------------------MOD_ATT:N-N-------------------------+       +------------------------------------------SUBJ:V-N------------------------------------------+                                                                       
                |        +---------------------MOD_ATT:N-N---------------------+----------------------------------COMP:V-N(of)----------------------------------+                   |                                                                       
                |        |                                 +----MOD_ATT:N-N----+       |                                              +--MOD_ATT:N-N--+-----------SUBJ:V-N----------+               +----SUBJ:V-N---+           +----COMP:N-N(of)----+      
                |        |                                 |            +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+-SUBJ:V-N+COMP:N-N(of+       |               |          +-NEG+COMP:V-N(in+          +MOD_ATT:N+      
                |        |                                 |            |      |       |                               |              |       |       |         |           |       |               |          |    |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (__SP__,promoter)
MOD_ATT:N-N (__SP__,fragment)
MOD_ATT:N-N (__SP__,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:V-N(of) (consist,__SP__)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__SP__)
COMP:V-N(of) (__NODE__,__SP__)
SUBJ:V-N (__NODE__,__NODE__)
SUBJ:V-N (__NODE__,complex)
SUBJ:V-N (occur,__NODE__)
NEG (occur,not)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 29

                                                                               +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                                      +-------------------------------SUBJ:V-N------------------------------+                                       
                                                                               |       |                                                      +---------------------------OBJ:V-N--------------------------+        |                                       
                                                                               |       |                                                      |                 +-----------------SUBJ:V-N-----------------+        |                                       
                                                                               |       |                                                      |                 +------------COMP:N-N(of)-----------+      |        |                                       
    +---------------OBJ:V-N---------------+                                    |       |                                                      |                 +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
    |           +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              +MOD_ATT+       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
    |           |        |                |                             |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,CTCAGAACATAAAGAACAGAG)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 30

                                                                               +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                                      +-------------------------------SUBJ:V-N------------------------------+                                       
                                                                               |       |                                                      +---------------------------OBJ:V-N--------------------------+        |                                       
                                                                               |       |                                                      |                 +-----------------SUBJ:V-N-----------------+        |                                       
                                                                               |       |                                                      |                 +------------COMP:N-N(of)-----------+      |        |                                       
    +---------------OBJ:V-N---------------+                                    |       |                                                      |                 +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
    |           +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              +MOD_ATT+       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
    |           |        |                |                             |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,CTCAGAACATAAAGAACAGAG)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 31

                                                                               +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                                      +-------------------------------SUBJ:V-N------------------------------+                                       
                                                                               |       |                                                      +---------------------------OBJ:V-N--------------------------+        |                                       
                                                                               |       |                                                      |                 +-----------------SUBJ:V-N-----------------+        |                                       
                                                                               |       |                                                      |                 +------------COMP:N-N(of)-----------+      |        |                                       
    +---------------OBJ:V-N---------------+                                    |       |                                                      |                 +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
    |           +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              +MOD_ATT+       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
    |           |        |                |                             |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,CTCAGAACATAAAGAACAGAG)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 32

                                                                               +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                                      +-------------------------------SUBJ:V-N------------------------------+                                       
                                                                               |       |                                                      +---------------------------OBJ:V-N--------------------------+        |                                       
                                                                               |       |                                                      |                 +-----------------SUBJ:V-N-----------------+        |                                       
                                                                               |       |                                                      |                 +------------COMP:N-N(of)-----------+      |        |                                       
    +---------------OBJ:V-N---------------+                                    |       |                                                      |                 +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
    |           +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              +MOD_ATT+       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
    |           |        |                |                             |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,CTCAGAACATAAAGAACAGAG)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 33

                                                                               +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                                              +---------------------------SUBJ:V-N--------------------------+                                       
                                                                               |       |                                                              +-----------------------OBJ:V-N----------------------+        |                                       
                                                                               |       |                                                              |         +-----------------SUBJ:V-N-----------------+        |                                       
                                                                               |       |                                                              |         +------------COMP:N-N(of)-----------+      |        |                                       
    +---------------OBJ:V-N---------------+                                    |       |                                              +--MOD_ATT:N-N--+         +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
    |           +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+         |           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
    |           |        |                |                             |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,CTCAGAACATAAAGAACAGAG)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,complex)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,complex)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 34

                                                                               +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                                              +---------------------------SUBJ:V-N--------------------------+                                       
                                                                               |       |                                                              +-----------------------OBJ:V-N----------------------+        |                                       
                                                                               |       |                                                              |         +-----------------SUBJ:V-N-----------------+        |                                       
                                                                               |       |                                                              |         +------------COMP:N-N(of)-----------+      |        |                                       
    +---------------OBJ:V-N---------------+                                    |       |                                              +--MOD_ATT:N-N--+         +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
    |           +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+         |           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
    |           |        |                |                             |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,CTCAGAACATAAAGAACAGAG)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,complex)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,complex)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 35

                                                                               +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                              +-----------------------------------SUBJ:V-N----------------------------------+                                       
                                                                               |       |                                              +-------------------------------OBJ:V-N------------------------------+        |                                       
                                                                               |       |                                              |                         +-----------------SUBJ:V-N-----------------+        |                                       
                                                                               |       |                                              |                         +------------COMP:N-N(of)-----------+      |        |                                       
    +---------------OBJ:V-N---------------+                                    |       |                                              |       +---MOD_ATT:N-N---+----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
    |           +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              |       |       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
    |           |        |                |                             |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,CTCAGAACATAAAGAACAGAG)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 36

                                                                               +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                                              +---------------------------SUBJ:V-N--------------------------+                                       
                                                                               |       |                                                              +-----------------------OBJ:V-N----------------------+        |                                       
                                                                               |       |                                                              |         +-----------------SUBJ:V-N-----------------+        |                                       
                                                                               |       |                                                              |         +------------COMP:N-N(of)-----------+      |        |                                       
    +---------------OBJ:V-N---------------+                                    |       |                                              +--MOD_ATT:N-N--+         +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
    |           +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+         |           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
    |           |        |                |                             |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,CTCAGAACATAAAGAACAGAG)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,complex)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,complex)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 37

                                                                               +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                              +-----------------------------------SUBJ:V-N----------------------------------+                                       
                                                                               |       |                                              +-------------------------------OBJ:V-N------------------------------+        |                                       
                                                                               |       |                                              |                         +-----------------SUBJ:V-N-----------------+        |                                       
                                                                               |       |                                              |                         +------------COMP:N-N(of)-----------+      |        |                                       
    +---------------OBJ:V-N---------------+                                    |       |                                              |       +---MOD_ATT:N-N---+----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
    |           +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              |       |       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
    |           |        |                |                             |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,CTCAGAACATAAAGAACAGAG)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 38

                                                                               +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                                              +---------------------------SUBJ:V-N--------------------------+                                       
                                                                               |       |                                                              +-----------------------OBJ:V-N----------------------+        |                                       
                                                                               |       |                                                              |         +-----------------SUBJ:V-N-----------------+        |                                       
                                                                               |       |                                                              |         +------------COMP:N-N(of)-----------+      |        |                                       
    +---------------OBJ:V-N---------------+                                    |       |                                              +--MOD_ATT:N-N--+         +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
    |           +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+         |           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
    |           |        |                |                             |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,CTCAGAACATAAAGAACAGAG)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,complex)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,complex)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 39

                                                                               +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                                      +-------------------------------SUBJ:V-N------------------------------+                                       
                                                                               |       |                                                      +---------------------------OBJ:V-N--------------------------+        |                                       
                                                                               |       |                                                      |                 +-----------------SUBJ:V-N-----------------+        |                                       
                                                                               |       |                                                      |                 +------------COMP:N-N(of)-----------+      |        |                                       
    +---------------OBJ:V-N---------------+                                    |       |                                                      |                 +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
    |           +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              +MOD_ATT+       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
    |           |        |                |                             |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,CTCAGAACATAAAGAACAGAG)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 40

                                                                               +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                                      +-------------------------------SUBJ:V-N------------------------------+                                       
                                                                               |       |                                                      +---------------------------OBJ:V-N--------------------------+        |                                       
                                                                               |       |                                                      |                 +-----------------SUBJ:V-N-----------------+        |                                       
                                                                               |       |                                                      |                 +------------COMP:N-N(of)-----------+      |        |                                       
    +---------------OBJ:V-N---------------+                                    |       |                                                      |                 +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
    |           +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              +MOD_ATT+       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
    |           |        |                |                             |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,CTCAGAACATAAAGAACAGAG)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 41

                                                                               +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                                      +-------------------------------SUBJ:V-N------------------------------+                                       
                                                                               |       |                                                      +---------------------------OBJ:V-N--------------------------+        |                                       
                                                                               |       |                                                      |                 +-----------------SUBJ:V-N-----------------+        |                                       
                                                                               |       |                                                      |                 +------------COMP:N-N(of)-----------+      |        |                                       
    +---------------OBJ:V-N---------------+                                    |       |                                                      |                 +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
    |           +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              +MOD_ATT+       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
    |           |        |                |                             |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,CTCAGAACATAAAGAACAGAG)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 42

                                                                               +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                              +-----------------------------------SUBJ:V-N----------------------------------+                                       
                                                                               |       |                                              +-------------------------------OBJ:V-N------------------------------+        |                                       
                                                                               |       |                                              |                         +-----------------SUBJ:V-N-----------------+        |                                       
                                                                               |       |                                              |                         +------------COMP:N-N(of)-----------+      |        |                                       
    +---------------OBJ:V-N---------------+                                    |       |                                              |       +---MOD_ATT:N-N---+----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
    |           +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              |       |       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
    |           |        |                |                             |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,CTCAGAACATAAAGAACAGAG)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 43

                                                                               +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                                              +---------------------------SUBJ:V-N--------------------------+                                       
                                                                               |       |                                                              +-----------------------OBJ:V-N----------------------+        |                                       
                                                                               |       |                                                              |         +-----------------SUBJ:V-N-----------------+        |                                       
                                                                               |       |                                                              |         +------------COMP:N-N(of)-----------+      |        |                                       
    +---------------OBJ:V-N---------------+                                    |       |                                              +--MOD_ATT:N-N--+         +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
    |           +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+         |           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
    |           |        |                |                             |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,CTCAGAACATAAAGAACAGAG)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,complex)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,complex)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 44

                                                                               +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                                              +---------------------------SUBJ:V-N--------------------------+                                       
                                                                               |       |                                                              +-----------------------OBJ:V-N----------------------+        |                                       
                                                                               |       |                                                              |         +-----------------SUBJ:V-N-----------------+        |                                       
                                                                               |       |                                                              |         +------------COMP:N-N(of)-----------+      |        |                                       
    +---------------OBJ:V-N---------------+                                    |       |                                              +--MOD_ATT:N-N--+         +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
    |           +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+         |           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
    |           |        |                |                             |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,CTCAGAACATAAAGAACAGAG)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,complex)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,complex)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 45

                                                                               +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                                              +---------------------------SUBJ:V-N--------------------------+                                       
                                                                               |       |                                                              +-----------------------OBJ:V-N----------------------+        |                                       
                                                                               |       |                                                              |         +-----------------SUBJ:V-N-----------------+        |                                       
                                                                               |       |                                                              |         +------------COMP:N-N(of)-----------+      |        |                                       
    +---------------OBJ:V-N---------------+                                    |       |                                              +--MOD_ATT:N-N--+         +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
    |           +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+         |           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
    |           |        |                |                             |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,CTCAGAACATAAAGAACAGAG)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,complex)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,complex)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 46

                                                                               +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                                      +-------------------------------SUBJ:V-N------------------------------+                                       
                                                                               |       |                                                      +---------------------------OBJ:V-N--------------------------+        |                                       
                                                                               |       |                                                      |                 +-----------------SUBJ:V-N-----------------+        |                                       
                                                                               |       |                                                      |                 +------------COMP:N-N(of)-----------+      |        |                                       
                                                                               |       |                                                      |                 +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
    +------------------------OBJ:V-N-----------------------+            +MOD_AT+       +-------------APPOS-------------+              +MOD_ATT+       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
    |                                                      |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 47

                                                                               +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                                      +-------------------------------SUBJ:V-N------------------------------+                                       
                                                                               |       |                                                      +---------------------------OBJ:V-N--------------------------+        |                                       
                                                                               |       |                                                      |                 +-----------------SUBJ:V-N-----------------+        |                                       
                                                                               |       |                                                      |                 +------------COMP:N-N(of)-----------+      |        |                                       
                                                                               |       |                                                      |                 +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
    +------------------------OBJ:V-N-----------------------+            +MOD_AT+       +-------------APPOS-------------+              +MOD_ATT+       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
    |                                                      |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 48

                                                                               +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                              +-----------------------------------SUBJ:V-N----------------------------------+                                       
                                                                               |       |                                              +-------------------------------OBJ:V-N------------------------------+        |                                       
                                                                               |       |                                              |                         +-----------------SUBJ:V-N-----------------+        |                                       
                                                                               |       |                                              |                         +------------COMP:N-N(of)-----------+      |        |                                       
                                                                               |       |                                              |       +---MOD_ATT:N-N---+----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
    +------------------------OBJ:V-N-----------------------+            +MOD_AT+       +-------------APPOS-------------+              |       |       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
    |                                                      |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 49

                                                                               +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                                              +---------------------------SUBJ:V-N--------------------------+                                       
                                                                               |       |                                                              +-----------------------OBJ:V-N----------------------+        |                                       
                                                                               |       |                                                              |         +-----------------SUBJ:V-N-----------------+        |                                       
                                                                               |       |                                                              |         +------------COMP:N-N(of)-----------+      |        |                                       
                                                                               |       |                                              +--MOD_ATT:N-N--+         +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
    +------------------------OBJ:V-N-----------------------+            +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+         |           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
    |                                                      |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,complex)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,complex)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 50

                                                                               +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                                              +---------------------------SUBJ:V-N--------------------------+                                       
                                                                               |       |                                                              +-----------------------OBJ:V-N----------------------+        |                                       
                                                                               |       |                                                              |         +-----------------SUBJ:V-N-----------------+        |                                       
                                                                               |       |                                                              |         +------------COMP:N-N(of)-----------+      |        |                                       
                                                                               |       |                                              +--MOD_ATT:N-N--+         +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
    +------------------------OBJ:V-N-----------------------+            +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+         |           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
    |                                                      |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,complex)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,complex)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 51

                                                                               +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                                      +-------------------------------SUBJ:V-N------------------------------+                                       
                                                                               |       |                                                      +---------------------------OBJ:V-N--------------------------+        |                                       
                                                                               |       |                                                      |                 +-----------------SUBJ:V-N-----------------+        |                                       
                                                                               |       |                                                      |                 +------------COMP:N-N(of)-----------+      |        |                                       
                                                                               |       |                                                      |                 +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
    +------------------------OBJ:V-N-----------------------+            +MOD_AT+       +-------------APPOS-------------+              +MOD_ATT+       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
    |                                                      |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 52

                                                                               +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                                      +-------------------------------SUBJ:V-N------------------------------+                                       
                                                                               |       |                                                      +---------------------------OBJ:V-N--------------------------+        |                                       
                                                                               |       |                                                      |                 +-----------------SUBJ:V-N-----------------+        |                                       
                                                                               |       |                                                      |                 +------------COMP:N-N(of)-----------+      |        |                                       
                                                                               |       |                                                      |                 +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
    +------------------------OBJ:V-N-----------------------+            +MOD_AT+       +-------------APPOS-------------+              +MOD_ATT+       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
    |                                                      |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 53

                                                                               +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                                      +-------------------------------SUBJ:V-N------------------------------+                                       
                                                                               |       |                                                      +---------------------------OBJ:V-N--------------------------+        |                                       
                                                                               |       |                                                      |                 +-----------------SUBJ:V-N-----------------+        |                                       
                                                                               |       |                                                      |                 +------------COMP:N-N(of)-----------+      |        |                                       
                                                                               |       |                                                      |                 +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
    +------------------------OBJ:V-N-----------------------+            +MOD_AT+       +-------------APPOS-------------+              +MOD_ATT+       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
    |                                                      |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 54

                                                                               +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                                      +-------------------------------SUBJ:V-N------------------------------+                                       
                                                                               |       |                                                      +---------------------------OBJ:V-N--------------------------+        |                                       
                                                                               |       |                                                      |                 +-----------------SUBJ:V-N-----------------+        |                                       
                                                                               |       |                                                      |                 +------------COMP:N-N(of)-----------+      |        |                                       
                                                                               |       |                                                      |                 +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
    +------------------------OBJ:V-N-----------------------+            +MOD_AT+       +-------------APPOS-------------+              +MOD_ATT+       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
    |                                                      |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 55

                                                                               +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                                      +-------------------------------SUBJ:V-N------------------------------+                                       
                                                                               |       |                                                      +---------------------------OBJ:V-N--------------------------+        |                                       
                                                                               |       |                                                      |                 +-----------------SUBJ:V-N-----------------+        |                                       
                                                                               |       |                                                      |                 +------------COMP:N-N(of)-----------+      |        |                                       
                                                                               |       |                                                      |                 +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
    +------------------------OBJ:V-N-----------------------+            +MOD_AT+       +-------------APPOS-------------+              +MOD_ATT+       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
    |                                                      |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 56

                                                                               +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                                      +-------------------------------SUBJ:V-N------------------------------+                                       
                                                                               |       |                                                      +---------------------------OBJ:V-N--------------------------+        |                                       
                                                                               |       |                                                      |                 +-----------------SUBJ:V-N-----------------+        |                                       
                                                                               |       |                                                      |                 +------------COMP:N-N(of)-----------+      |        |                                       
                                                                               |       |                                                      |                 +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
    +------------------------OBJ:V-N-----------------------+            +MOD_AT+       +-------------APPOS-------------+              +MOD_ATT+       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
    |                                                      |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 57

                                                                               +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                                      +-------------------------------SUBJ:V-N------------------------------+                                       
                                                                               |       |                                                      +---------------------------OBJ:V-N--------------------------+        |                                       
                                                                               |       |                                                      |                 +-----------------SUBJ:V-N-----------------+        |                                       
                                                                               |       |                                                      |                 +------------COMP:N-N(of)-----------+      |        |                                       
                                                                               |       |                                                      |                 +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
    +------------------------OBJ:V-N-----------------------+            +MOD_AT+       +-------------APPOS-------------+              +MOD_ATT+       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
    |                                                      |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 58

                                                                               +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                                      +-------------------------------SUBJ:V-N------------------------------+                                       
                                                                               |       |                                                      +---------------------------OBJ:V-N--------------------------+        |                                       
                                                                               |       |                                                      |                 +-----------------SUBJ:V-N-----------------+        |                                       
                                                                               |       |                                                      |                 +------------COMP:N-N(of)-----------+      |        |                                       
                                                                               |       |                                                      |                 +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
    +------------------------OBJ:V-N-----------------------+            +MOD_AT+       +-------------APPOS-------------+              +MOD_ATT+       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
    |                                                      |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 59

                                                                               +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                              +-----------------------------------SUBJ:V-N----------------------------------+                                       
                                                                               |       |                                              +-------------------------------OBJ:V-N------------------------------+        |                                       
                                                                               |       |                                              |                         +-----------------SUBJ:V-N-----------------+        |                                       
                                                                               |       |                                              |                         +------------COMP:N-N(of)-----------+      |        |                                       
                                                                               |       |                                              |       +---MOD_ATT:N-N---+----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
    +------------------------OBJ:V-N-----------------------+            +MOD_AT+       +-------------APPOS-------------+              |       |       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
    |                                                      |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 60

                                                                               +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                                              +---------------------------SUBJ:V-N--------------------------+                                       
                                                                               |       |                                                              +-----------------------OBJ:V-N----------------------+        |                                       
                                                                               |       |                                                              |         +-----------------SUBJ:V-N-----------------+        |                                       
                                                                               |       |                                                              |         +------------COMP:N-N(of)-----------+      |        |                                       
                                                                               |       |                                              +--MOD_ATT:N-N--+         +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
    +------------------------OBJ:V-N-----------------------+            +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+         |           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
    |                                                      |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,complex)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,complex)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 61

                                                                               +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                                              +---------------------------SUBJ:V-N--------------------------+                                       
                                                                               |       |                                                              +-----------------------OBJ:V-N----------------------+        |                                       
                                                                               |       |                                                              |         +-----------------SUBJ:V-N-----------------+        |                                       
                                                                               |       |                                                              |         +------------COMP:N-N(of)-----------+      |        |                                       
                                                                               |       |                                              +--MOD_ATT:N-N--+         +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
    +------------------------OBJ:V-N-----------------------+            +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+         |           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
    |                                                      |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,complex)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,complex)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 62

                                                                               +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                              +-----------------------------------SUBJ:V-N----------------------------------+                                       
                                                                               |       |                                              +-------------------------------OBJ:V-N------------------------------+        |                                       
                                                                               |       |                                              |                         +-----------------SUBJ:V-N-----------------+        |                                       
                                                                               |       |                                              |                         +------------COMP:N-N(of)-----------+      |        |                                       
                                                                               |       |                                              |       +---MOD_ATT:N-N---+----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
    +------------------------OBJ:V-N-----------------------+            +MOD_AT+       +-------------APPOS-------------+              |       |       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
    |                                                      |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 63

                                                                               +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                              +-----------------------------------SUBJ:V-N----------------------------------+                                       
                                                                               |       |                                              +-------------------------------OBJ:V-N------------------------------+        |                                       
                                                                               |       |                                              |                         +-----------------SUBJ:V-N-----------------+        |                                       
                                                                               |       |                                              |                         +------------COMP:N-N(of)-----------+      |        |                                       
                                                                               |       |                                              |       +---MOD_ATT:N-N---+----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
    +------------------------OBJ:V-N-----------------------+            +MOD_AT+       +-------------APPOS-------------+              |       |       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
    |                                                      |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 64

                                                                               +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                                              +---------------------------SUBJ:V-N--------------------------+                                       
                                                                               |       |                                                              +-----------------------OBJ:V-N----------------------+        |                                       
                                                                               |       |                                                              |         +-----------------SUBJ:V-N-----------------+        |                                       
                                                                               |       |                                                              |         +------------COMP:N-N(of)-----------+      |        |                                       
                                                                               |       |                                              +--MOD_ATT:N-N--+         +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
    +------------------------OBJ:V-N-----------------------+            +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+         |           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
    |                                                      |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,complex)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,complex)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 65

                                          +-------------------------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------------------------+                                       
                                          |                                    +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                          |                                    |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                          |                                    |       |                                                      +-------------------------------SUBJ:V-N------------------------------+                                       
                                          |                                    |       |                                                      +---------------------------OBJ:V-N--------------------------+        |                                       
                                          |                                    |       |                                                      |                 +-----------------SUBJ:V-N-----------------+        |                                       
                                          |                                    |       |                                                      |                 +------------COMP:N-N(of)-----------+      |        |                                       
                                          |                                    |       |                                                      |                 +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              +MOD_ATT+       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                |        |                |                             |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,CTCAGAACATAAAGAACAGAG)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 66

                                          +-------------------------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------------------------+                                       
                                          |                                    +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                          |                                    |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                          |                                    |       |                                                      +-------------------------------SUBJ:V-N------------------------------+                                       
                                          |                                    |       |                                                      +---------------------------OBJ:V-N--------------------------+        |                                       
                                          |                                    |       |                                                      |                 +-----------------SUBJ:V-N-----------------+        |                                       
                                          |                                    |       |                                                      |                 +------------COMP:N-N(of)-----------+      |        |                                       
                                          |                                    |       |                                                      |                 +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              +MOD_ATT+       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                |        |                |                             |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,CTCAGAACATAAAGAACAGAG)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 67

                                          +-------------------------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------------------------+                                       
                                          |                                    +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                          |                                    |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                          |                                    |       |                                                      +-------------------------------SUBJ:V-N------------------------------+                                       
                                          |                                    |       |                                                      +---------------------------OBJ:V-N--------------------------+        |                                       
                                          |                                    |       |                                                      |                 +-----------------SUBJ:V-N-----------------+        |                                       
                                          |                                    |       |                                                      |                 +------------COMP:N-N(of)-----------+      |        |                                       
                                          |                                    |       |                                                      |                 +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              +MOD_ATT+       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                |        |                |                             |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,CTCAGAACATAAAGAACAGAG)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 68

                                          +-------------------------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------------------------+                                       
                                          |                                    +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                          |                                    |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                          |                                    |       |                                                              +---------------------------SUBJ:V-N--------------------------+                                       
                                          |                                    |       |                                                              +-----------------------OBJ:V-N----------------------+        |                                       
                                          |                                    |       |                                                              |         +-----------------SUBJ:V-N-----------------+        |                                       
                                          |                                    |       |                                                              |         +------------COMP:N-N(of)-----------+      |        |                                       
                                          |                                    |       |                                              +--MOD_ATT:N-N--+         +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+         |           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                |        |                |                             |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,complex)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,CTCAGAACATAAAGAACAGAG)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,complex)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 69

                                          +-------------------------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------------------------+                                       
                                          |                                    +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                          |                                    |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                          |                                    |       |                                                              +---------------------------SUBJ:V-N--------------------------+                                       
                                          |                                    |       |                                                              +-----------------------OBJ:V-N----------------------+        |                                       
                                          |                                    |       |                                                              |         +-----------------SUBJ:V-N-----------------+        |                                       
                                          |                                    |       |                                                              |         +------------COMP:N-N(of)-----------+      |        |                                       
                                          |                                    |       |                                              +--MOD_ATT:N-N--+         +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+         |           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                |        |                |                             |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,complex)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,CTCAGAACATAAAGAACAGAG)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,complex)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 70

                                          +-------------------------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------------------------+                                       
                                          |                                    +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                          |                                    |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                          |                                    |       |                                              +-----------------------------------SUBJ:V-N----------------------------------+                                       
                                          |                                    |       |                                              +-------------------------------OBJ:V-N------------------------------+        |                                       
                                          |                                    |       |                                              |                         +-----------------SUBJ:V-N-----------------+        |                                       
                                          |                                    |       |                                              |                         +------------COMP:N-N(of)-----------+      |        |                                       
                                          |                                    |       |                                              |       +---MOD_ATT:N-N---+----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              |       |       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                |        |                |                             |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,CTCAGAACATAAAGAACAGAG)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 71

                                          +-------------------------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------------------------+                                       
                                          |                                    +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                          |                                    |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                          |                                    |       |                                                              +---------------------------SUBJ:V-N--------------------------+                                       
                                          |                                    |       |                                                              +-----------------------OBJ:V-N----------------------+        |                                       
                                          |                                    |       |                                                              |         +-----------------SUBJ:V-N-----------------+        |                                       
                                          |                                    |       |                                                              |         +------------COMP:N-N(of)-----------+      |        |                                       
                                          |                                    |       |                                              +--MOD_ATT:N-N--+         +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+         |           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                |        |                |                             |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,complex)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,CTCAGAACATAAAGAACAGAG)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,complex)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 72

                                                                               +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                              +-----------------------------------SUBJ:V-N----------------------------------+                                       
                                                                               |       |                                              +-------------------------------OBJ:V-N------------------------------+        |                                       
                                                                               |       |                                              |                         +-----------------SUBJ:V-N-----------------+        |                                       
                                                                               |       |                                              |                         +------------COMP:N-N(of)-----------+      |        |                                       
    +---------------OBJ:V-N---------------+                                    |       |                                              |       +---MOD_ATT:N-N---+----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
    |           +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              |       |       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
    |           |        |                |                             |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,CTCAGAACATAAAGAACAGAG)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 73

                                                                               +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                              +-----------------------------------SUBJ:V-N----------------------------------+                                       
                                                                               |       |                                              +-------------------------------OBJ:V-N------------------------------+        |                                       
                                                                               |       |                                              |                         +-----------------SUBJ:V-N-----------------+        |                                       
                                                                               |       |                                              |                         +------------COMP:N-N(of)-----------+      |        |                                       
    +---------------OBJ:V-N---------------+                                    |       |                                              |       +---MOD_ATT:N-N---+----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
    |           +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              |       |       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
    |           |        |                |                             |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,CTCAGAACATAAAGAACAGAG)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 74

                                                                               +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                              +-----------------------------------SUBJ:V-N----------------------------------+                                       
                                                                               |       |                                              +-------------------------------OBJ:V-N------------------------------+        |                                       
                                                                               |       |                                              |                         +-----------------SUBJ:V-N-----------------+        |                                       
                                                                               |       |                                              |                         +------------COMP:N-N(of)-----------+      |        |                                       
    +---------------OBJ:V-N---------------+                                    |       |                                              |       +---MOD_ATT:N-N---+----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
    |           +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              |       |       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
    |           |        |                |                             |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,CTCAGAACATAAAGAACAGAG)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 75

                                          +-------------------------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------------------------+                                       
                                          |                                    +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                          |                                    |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                          |                                    |       |                                                      +-------------------------------SUBJ:V-N------------------------------+                                       
                                          |                                    |       |                                                      +---------------------------OBJ:V-N--------------------------+        |                                       
                                          |                                    |       |                                                      |                 +-----------------SUBJ:V-N-----------------+        |                                       
                                          |                                    |       |                                                      |                 +------------COMP:N-N(of)-----------+      |        |                                       
                                          |                                    |       |                                                      |                 +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              +MOD_ATT+       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                |        |                |                             |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,CTCAGAACATAAAGAACAGAG)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 76

                                          +-------------------------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------------------------+                                       
                                          |                                    +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                          |                                    |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                          |                                    |       |                                                      +-------------------------------SUBJ:V-N------------------------------+                                       
                                          |                                    |       |                                                      +---------------------------OBJ:V-N--------------------------+        |                                       
                                          |                                    |       |                                                      |                 +-----------------SUBJ:V-N-----------------+        |                                       
                                          |                                    |       |                                                      |                 +------------COMP:N-N(of)-----------+      |        |                                       
                                          |                                    |       |                                                      |                 +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              +MOD_ATT+       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                |        |                |                             |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,CTCAGAACATAAAGAACAGAG)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 77

                                          +-------------------------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------------------------+                                       
                                          |                                    +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                          |                                    |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                          |                                    |       |                                                      +-------------------------------SUBJ:V-N------------------------------+                                       
                                          |                                    |       |                                                      +---------------------------OBJ:V-N--------------------------+        |                                       
                                          |                                    |       |                                                      |                 +-----------------SUBJ:V-N-----------------+        |                                       
                                          |                                    |       |                                                      |                 +------------COMP:N-N(of)-----------+      |        |                                       
                                          |                                    |       |                                                      |                 +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              +MOD_ATT+       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                |        |                |                             |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,CTCAGAACATAAAGAACAGAG)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 78

                                          +-------------------------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------------------------+                                       
                                          |                                    +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                          |                                    |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                          |                                    |       |                                                      +-------------------------------SUBJ:V-N------------------------------+                                       
                                          |                                    |       |                                                      +---------------------------OBJ:V-N--------------------------+        |                                       
                                          |                                    |       |                                                      |                 +-----------------SUBJ:V-N-----------------+        |                                       
                                          |                                    |       |                                                      |                 +------------COMP:N-N(of)-----------+      |        |                                       
                                          |                                    |       |                                                      |                 +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              +MOD_ATT+       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                |        |                |                             |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,CTCAGAACATAAAGAACAGAG)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 79

                                          +-------------------------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------------------------+                                       
                                          |                                    +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                          |                                    |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                          |                                    |       |                                                      +-------------------------------SUBJ:V-N------------------------------+                                       
                                          |                                    |       |                                                      +---------------------------OBJ:V-N--------------------------+        |                                       
                                          |                                    |       |                                                      |                 +-----------------SUBJ:V-N-----------------+        |                                       
                                          |                                    |       |                                                      |                 +------------COMP:N-N(of)-----------+      |        |                                       
                                          |                                    |       |                                                      |                 +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              +MOD_ATT+       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                |        |                |                             |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,CTCAGAACATAAAGAACAGAG)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 80

                                          +-------------------------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------------------------+                                       
                                          |                                    +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                          |                                    |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                          |                                    |       |                                              +-----------------------------------SUBJ:V-N----------------------------------+                                       
                                          |                                    |       |                                              +-------------------------------OBJ:V-N------------------------------+        |                                       
                                          |                                    |       |                                              |                         +-----------------SUBJ:V-N-----------------+        |                                       
                                          |                                    |       |                                              |                         +------------COMP:N-N(of)-----------+      |        |                                       
                                          |                                    |       |                                              |       +---MOD_ATT:N-N---+----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              |       |       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                |        |                |                             |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,CTCAGAACATAAAGAACAGAG)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 81

                                          +-------------------------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------------------------+                                       
                                          |                                    +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                          |                                    |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                          |                                    |       |                                              +-----------------------------------SUBJ:V-N----------------------------------+                                       
                                          |                                    |       |                                              +-------------------------------OBJ:V-N------------------------------+        |                                       
                                          |                                    |       |                                              |                         +-----------------SUBJ:V-N-----------------+        |                                       
                                          |                                    |       |                                              |                         +------------COMP:N-N(of)-----------+      |        |                                       
                                          |                                    |       |                                              |       +---MOD_ATT:N-N---+----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              |       |       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                |        |                |                             |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,CTCAGAACATAAAGAACAGAG)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 82

                                          +-------------------------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------------------------+                                       
                                          |                                    +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                          |                                    |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                          |                                    |       |                                                              +---------------------------SUBJ:V-N--------------------------+                                       
                                          |                                    |       |                                                              +-----------------------OBJ:V-N----------------------+        |                                       
                                          |                                    |       |                                                              |         +-----------------SUBJ:V-N-----------------+        |                                       
                                          |                                    |       |                                                              |         +------------COMP:N-N(of)-----------+      |        |                                       
                                          |                                    |       |                                              +--MOD_ATT:N-N--+         +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+         |           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                |        |                |                             |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,complex)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,CTCAGAACATAAAGAACAGAG)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,complex)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 83

                                          +-------------------------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------------------------+                                       
                                          |                                    +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                          |                                    |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                          |                                    |       |                                              +-----------------------------------SUBJ:V-N----------------------------------+                                       
                                          |                                    |       |                                              +-------------------------------OBJ:V-N------------------------------+        |                                       
                                          |                                    |       |                                              |                         +-----------------SUBJ:V-N-----------------+        |                                       
                                          |                                    |       |                                              |                         +------------COMP:N-N(of)-----------+      |        |                                       
                                          |                                    |       |                                              |       +---MOD_ATT:N-N---+----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              |       |       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                |        |                |                             |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,CTCAGAACATAAAGAACAGAG)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 84

                                          +-------------------------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------------------------+                                       
                                          |                                    +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                          |                                    |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                          |                                    |       |                                              +-----------------------------------SUBJ:V-N----------------------------------+                                       
                                          |                                    |       |                                              +-------------------------------OBJ:V-N------------------------------+        |                                       
                                          |                                    |       |                                              |                         +-----------------SUBJ:V-N-----------------+        |                                       
                                          |                                    |       |                                              |                         +------------COMP:N-N(of)-----------+      |        |                                       
                                          |                                    |       |                                              |       +---MOD_ATT:N-N---+----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              |       |       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                |        |                |                             |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,CTCAGAACATAAAGAACAGAG)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 85

                                                           +----------------------------------------------------------------------COMP:V-N(of)----------------------------------------------------------------------+                                       
                                                           |                   +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                           |                   |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                           |                   |       |                                                      +-------------------------------SUBJ:V-N------------------------------+                                       
                                                           |                   |       |                                                      +---------------------------OBJ:V-N--------------------------+        |                                       
                                                           |                   |       |                                                      |                 +-----------------SUBJ:V-N-----------------+        |                                       
                                                           |                   |       |                                                      |                 +------------COMP:N-N(of)-----------+      |        |                                       
                                                           |                   |       |                                                      |                 +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                                                           |            +MOD_AT+       +-------------APPOS-------------+              +MOD_ATT+       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                                                           |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,@card@)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 86

                                                           +----------------------------------------------------------------------COMP:V-N(of)----------------------------------------------------------------------+                                       
                                                           |                   +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                           |                   |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                           |                   |       |                                                      +-------------------------------SUBJ:V-N------------------------------+                                       
                                                           |                   |       |                                                      +---------------------------OBJ:V-N--------------------------+        |                                       
                                                           |                   |       |                                                      |                 +-----------------SUBJ:V-N-----------------+        |                                       
                                                           |                   |       |                                                      |                 +------------COMP:N-N(of)-----------+      |        |                                       
                                                           |                   |       |                                                      |                 +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                                                           |            +MOD_AT+       +-------------APPOS-------------+              +MOD_ATT+       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                                                           |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,@card@)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 87

                                                           +----------------------------------------------------------------------COMP:V-N(of)----------------------------------------------------------------------+                                       
                                                           |                   +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                           |                   |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                           |                   |       |                                                      +-------------------------------SUBJ:V-N------------------------------+                                       
                                                           |                   |       |                                                      +---------------------------OBJ:V-N--------------------------+        |                                       
                                                           |                   |       |                                                      |                 +-----------------SUBJ:V-N-----------------+        |                                       
                                                           |                   |       |                                                      |                 +------------COMP:N-N(of)-----------+      |        |                                       
                                                           |                   |       |                                                      |                 +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                                                           |            +MOD_AT+       +-------------APPOS-------------+              +MOD_ATT+       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                                                           |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,@card@)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 88

                                                           +----------------------------------------------------------------------COMP:V-N(of)----------------------------------------------------------------------+                                       
                                                           |                   +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                           |                   |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                           |                   |       |                                                              +---------------------------SUBJ:V-N--------------------------+                                       
                                                           |                   |       |                                                              +-----------------------OBJ:V-N----------------------+        |                                       
                                                           |                   |       |                                                              |         +-----------------SUBJ:V-N-----------------+        |                                       
                                                           |                   |       |                                                              |         +------------COMP:N-N(of)-----------+      |        |                                       
                                                           |                   |       |                                              +--MOD_ATT:N-N--+         +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                                                           |            +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+         |           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                                                           |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,complex)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,@card@)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,complex)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 89

                                                           +----------------------------------------------------------------------COMP:V-N(of)----------------------------------------------------------------------+                                       
                                                           |                   +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                           |                   |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                           |                   |       |                                                              +---------------------------SUBJ:V-N--------------------------+                                       
                                                           |                   |       |                                                              +-----------------------OBJ:V-N----------------------+        |                                       
                                                           |                   |       |                                                              |         +-----------------SUBJ:V-N-----------------+        |                                       
                                                           |                   |       |                                                              |         +------------COMP:N-N(of)-----------+      |        |                                       
                                                           |                   |       |                                              +--MOD_ATT:N-N--+         +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                                                           |            +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+         |           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                                                           |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,complex)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,@card@)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,complex)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 90

                                                           +----------------------------------------------------------------------COMP:V-N(of)----------------------------------------------------------------------+                                       
                                                           |                   +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                           |                   |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                           |                   |       |                                              +-----------------------------------SUBJ:V-N----------------------------------+                                       
                                                           |                   |       |                                              +-------------------------------OBJ:V-N------------------------------+        |                                       
                                                           |                   |       |                                              |                         +-----------------SUBJ:V-N-----------------+        |                                       
                                                           |                   |       |                                              |                         +------------COMP:N-N(of)-----------+      |        |                                       
                                                           |                   |       |                                              |       +---MOD_ATT:N-N---+----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                                                           |            +MOD_AT+       +-------------APPOS-------------+              |       |       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                                                           |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,@card@)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 91

                                                           +----------------------------------------------------------------------COMP:V-N(of)----------------------------------------------------------------------+                                       
                                                           |                   +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                           |                   |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                           |                   |       |                                              +-----------------------------------SUBJ:V-N----------------------------------+                                       
                                                           |                   |       |                                              +-------------------------------OBJ:V-N------------------------------+        |                                       
                                                           |                   |       |                                              |                         +-----------------SUBJ:V-N-----------------+        |                                       
                                                           |                   |       |                                              |                         +------------COMP:N-N(of)-----------+      |        |                                       
                                                           |                   |       |                                              |       +---MOD_ATT:N-N---+----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                                                           |            +MOD_AT+       +-------------APPOS-------------+              |       |       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                                                           |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,@card@)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 92

                                                           +----------------------------------------------------------------------COMP:V-N(of)----------------------------------------------------------------------+                                       
                                                           |                   +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                           |                   |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                           |                   |       |                                                              +---------------------------SUBJ:V-N--------------------------+                                       
                                                           |                   |       |                                                              +-----------------------OBJ:V-N----------------------+        |                                       
                                                           |                   |       |                                                              |         +-----------------SUBJ:V-N-----------------+        |                                       
                                                           |                   |       |                                                              |         +------------COMP:N-N(of)-----------+      |        |                                       
                                                           |                   |       |                                              +--MOD_ATT:N-N--+         +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                                                           |            +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+         |           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                                                           |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,complex)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,@card@)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,complex)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 93

                                                                               +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                              +-----------------------------------SUBJ:V-N----------------------------------+                                       
                                                                               |       |                                              +-------------------------------OBJ:V-N------------------------------+        |                                       
                                                                               |       |                                              |                         +-----------------SUBJ:V-N-----------------+        |                                       
                                                                               |       |                                              |                         +------------COMP:N-N(of)-----------+      |        |                                       
                                                                               |       |                                              |       +---MOD_ATT:N-N---+----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
    +------------------------OBJ:V-N-----------------------+            +MOD_AT+       +-------------APPOS-------------+              |       |       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
    |                                                      |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 94

                                                           +----------------------------------------------------------------------COMP:V-N(of)----------------------------------------------------------------------+                                       
                                                           |                   +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                           |                   |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                           |                   |       |                                                      +-------------------------------SUBJ:V-N------------------------------+                                       
                                                           |                   |       |                                                      +---------------------------OBJ:V-N--------------------------+        |                                       
                                                           |                   |       |                                                      |                 +-----------------SUBJ:V-N-----------------+        |                                       
                                                           |                   |       |                                                      |                 +------------COMP:N-N(of)-----------+      |        |                                       
                                                           |                   |       |                                                      |                 +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                                                           |            +MOD_AT+       +-------------APPOS-------------+              +MOD_ATT+       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                                                           |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,@card@)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 95

                                                           +----------------------------------------------------------------------COMP:V-N(of)----------------------------------------------------------------------+                                       
                                                           |                   +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                           |                   |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                           |                   |       |                                                      +-------------------------------SUBJ:V-N------------------------------+                                       
                                                           |                   |       |                                                      +---------------------------OBJ:V-N--------------------------+        |                                       
                                                           |                   |       |                                                      |                 +-----------------SUBJ:V-N-----------------+        |                                       
                                                           |                   |       |                                                      |                 +------------COMP:N-N(of)-----------+      |        |                                       
                                                           |                   |       |                                                      |                 +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                                                           |            +MOD_AT+       +-------------APPOS-------------+              +MOD_ATT+       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                                                           |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,@card@)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 96

                                                           +----------------------------------------------------------------------COMP:V-N(of)----------------------------------------------------------------------+                                       
                                                           |                   +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                           |                   |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                           |                   |       |                                                      +-------------------------------SUBJ:V-N------------------------------+                                       
                                                           |                   |       |                                                      +---------------------------OBJ:V-N--------------------------+        |                                       
                                                           |                   |       |                                                      |                 +-----------------SUBJ:V-N-----------------+        |                                       
                                                           |                   |       |                                                      |                 +------------COMP:N-N(of)-----------+      |        |                                       
                                                           |                   |       |                                                      |                 +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                                                           |            +MOD_AT+       +-------------APPOS-------------+              +MOD_ATT+       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                                                           |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,@card@)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 97

                                                           +----------------------------------------------------------------------COMP:V-N(of)----------------------------------------------------------------------+                                       
                                                           |                   +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                           |                   |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                           |                   |       |                                                      +-------------------------------SUBJ:V-N------------------------------+                                       
                                                           |                   |       |                                                      +---------------------------OBJ:V-N--------------------------+        |                                       
                                                           |                   |       |                                                      |                 +-----------------SUBJ:V-N-----------------+        |                                       
                                                           |                   |       |                                                      |                 +------------COMP:N-N(of)-----------+      |        |                                       
                                                           |                   |       |                                                      |                 +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                                                           |            +MOD_AT+       +-------------APPOS-------------+              +MOD_ATT+       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                                                           |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,@card@)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 98

                                                           +----------------------------------------------------------------------COMP:V-N(of)----------------------------------------------------------------------+                                       
                                                           |                   +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                           |                   |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                           |                   |       |                                                      +-------------------------------SUBJ:V-N------------------------------+                                       
                                                           |                   |       |                                                      +---------------------------OBJ:V-N--------------------------+        |                                       
                                                           |                   |       |                                                      |                 +-----------------SUBJ:V-N-----------------+        |                                       
                                                           |                   |       |                                                      |                 +------------COMP:N-N(of)-----------+      |        |                                       
                                                           |                   |       |                                                      |                 +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                                                           |            +MOD_AT+       +-------------APPOS-------------+              +MOD_ATT+       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                                                           |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,@card@)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 99

                                                           +----------------------------------------------------------------------COMP:V-N(of)----------------------------------------------------------------------+                                       
                                                           |                   +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                           |                   |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                           |                   |       |                                                      +-------------------------------SUBJ:V-N------------------------------+                                       
                                                           |                   |       |                                                      +---------------------------OBJ:V-N--------------------------+        |                                       
                                                           |                   |       |                                                      |                 +-----------------SUBJ:V-N-----------------+        |                                       
                                                           |                   |       |                                                      |                 +------------COMP:N-N(of)-----------+      |        |                                       
                                                           |                   |       |                                                      |                 +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                                                           |            +MOD_AT+       +-------------APPOS-------------+              +MOD_ATT+       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                                                           |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,@card@)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 100

                                                           +----------------------------------------------------------------------COMP:V-N(of)----------------------------------------------------------------------+                                       
                                                           |                   +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                           |                   |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                           |                   |       |                                                              +---------------------------SUBJ:V-N--------------------------+                                       
                                                           |                   |       |                                                              +-----------------------OBJ:V-N----------------------+        |                                       
                                                           |                   |       |                                                              |         +-----------------SUBJ:V-N-----------------+        |                                       
                                                           |                   |       |                                                              |         +------------COMP:N-N(of)-----------+      |        |                                       
                                                           |                   |       |                                              +--MOD_ATT:N-N--+         +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                                                           |            +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+         |           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                                                           |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,complex)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,@card@)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,complex)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 101

                                                                               +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                              +-----------------------------------SUBJ:V-N----------------------------------+                                       
                                                                               |       |                                              +-------------------------------OBJ:V-N------------------------------+        |                                       
                                                                               |       |                                              |                         +-----------------SUBJ:V-N-----------------+        |                                       
                                                                               |       |                                              |                         +------------COMP:N-N(of)-----------+      |        |                                       
                                                                               |       |                                              |       +---MOD_ATT:N-N---+----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
    +------------------------OBJ:V-N-----------------------+            +MOD_AT+       +-------------APPOS-------------+              |       |       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
    |                                                      |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 102

                                                                               +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                              +-----------------------------------SUBJ:V-N----------------------------------+                                       
                                                                               |       |                                              +-------------------------------OBJ:V-N------------------------------+        |                                       
                                                                               |       |                                              |                         +-----------------SUBJ:V-N-----------------+        |                                       
                                                                               |       |                                              |                         +------------COMP:N-N(of)-----------+      |        |                                       
                                                                               |       |                                              |       +---MOD_ATT:N-N---+----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
    +------------------------OBJ:V-N-----------------------+            +MOD_AT+       +-------------APPOS-------------+              |       |       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
    |                                                      |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
OBJ:V-N (bind,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 103

                                          +-------------------------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------------------------+                                       
                                          |                                    +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                          |                                    |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                          |                                    |       |                                              +-----------------------------------SUBJ:V-N----------------------------------+                                       
                                          |                                    |       |                                              +-------------------------------OBJ:V-N------------------------------+        |                                       
                                          |                                    |       |                                              |                         +-----------------SUBJ:V-N-----------------+        |                                       
                                          |                                    |       |                                              |                         +------------COMP:N-N(of)-----------+      |        |                                       
                                          |                                    |       |                                              |       +---MOD_ATT:N-N---+----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              |       |       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                |        |                |                             |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,CTCAGAACATAAAGAACAGAG)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 104

                                          +-------------------------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------------------------+                                       
                                          |                                    +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                          |                                    |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                          |                                    |       |                                              +-----------------------------------SUBJ:V-N----------------------------------+                                       
                                          |                                    |       |                                              +-------------------------------OBJ:V-N------------------------------+        |                                       
                                          |                                    |       |                                              |                         +-----------------SUBJ:V-N-----------------+        |                                       
                                          |                                    |       |                                              |                         +------------COMP:N-N(of)-----------+      |        |                                       
                                          |                                    |       |                                              |       +---MOD_ATT:N-N---+----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              |       |       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                |        |                |                             |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,CTCAGAACATAAAGAACAGAG)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 105

                                          +-------------------------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------------------------+                                       
                                          |                                    +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                          |                                    |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                          |                                    |       |                                              +-----------------------------------SUBJ:V-N----------------------------------+                                       
                                          |                                    |       |                                              +-------------------------------OBJ:V-N------------------------------+        |                                       
                                          |                                    |       |                                              |                         +-----------------SUBJ:V-N-----------------+        |                                       
                                          |                                    |       |                                              |                         +------------COMP:N-N(of)-----------+      |        |                                       
                                          |                                    |       |                                              |       +---MOD_ATT:N-N---+----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              |       |       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                |        |                |                             |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,CTCAGAACATAAAGAACAGAG)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 106

                                          +-------------------------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------------------------+                                       
                                          |                                    +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                          |                                    |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                          |                                    |       |                                              +-----------------------------------SUBJ:V-N----------------------------------+                                       
                                          |                                    |       |                                              +-------------------------------OBJ:V-N------------------------------+        |                                       
                                          |                                    |       |                                              |                         +-----------------SUBJ:V-N-----------------+        |                                       
                                          |                                    |       |                                              |                         +------------COMP:N-N(of)-----------+      |        |                                       
                                          |                                    |       |                                              |       +---MOD_ATT:N-N---+----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              |       |       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                |        |                |                             |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,CTCAGAACATAAAGAACAGAG)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 107

                                                                               +------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                                      +-------------------------------SUBJ:V-N------------------------------+                                       
                                                                               |       |                                                      +---------------------------OBJ:V-N--------------------------+        |                                       
                +--------------------------MOD_ATT:N-N-------------------------+       |                                                      |                 +-----------------SUBJ:V-N-----------------+        |                                       
                |        +---------------------MOD_ATT:N-N---------------------+       |                                                      |                 +------------COMP:N-N(of)-----------+      |        |                                       
                |        |                                 +----MOD_ATT:N-N----+       |                                                      |                 +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                |        |                                 |            +MOD_AT+       +-------------APPOS-------------+              +MOD_ATT+       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                |        |                                 |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (__SP__,promoter)
MOD_ATT:N-N (__SP__,fragment)
MOD_ATT:N-N (__SP__,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 108

                                                                               +------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                                      +-------------------------------SUBJ:V-N------------------------------+                                       
                                                                               |       |                                                      +---------------------------OBJ:V-N--------------------------+        |                                       
                +--------------------------MOD_ATT:N-N-------------------------+       |                                                      |                 +-----------------SUBJ:V-N-----------------+        |                                       
                |        +---------------------MOD_ATT:N-N---------------------+       |                                                      |                 +------------COMP:N-N(of)-----------+      |        |                                       
                |        |                                 +----MOD_ATT:N-N----+       |                                                      |                 +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                |        |                                 |            +MOD_AT+       +-------------APPOS-------------+              +MOD_ATT+       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                |        |                                 |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (__SP__,promoter)
MOD_ATT:N-N (__SP__,fragment)
MOD_ATT:N-N (__SP__,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 109

                                                                               +------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                                      +-------------------------------SUBJ:V-N------------------------------+                                       
                                                                               |       |                                                      +---------------------------OBJ:V-N--------------------------+        |                                       
                +--------------------------MOD_ATT:N-N-------------------------+       |                                                      |                 +-----------------SUBJ:V-N-----------------+        |                                       
                |        +---------------------MOD_ATT:N-N---------------------+       |                                                      |                 +------------COMP:N-N(of)-----------+      |        |                                       
                |        |                                 +----MOD_ATT:N-N----+       |                                                      |                 +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                |        |                                 |            +MOD_AT+       +-------------APPOS-------------+              +MOD_ATT+       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                |        |                                 |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (__SP__,promoter)
MOD_ATT:N-N (__SP__,fragment)
MOD_ATT:N-N (__SP__,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 110

                                                                               +------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                                      +-------------------------------SUBJ:V-N------------------------------+                                       
                                                                               |       |                                                      +---------------------------OBJ:V-N--------------------------+        |                                       
                +--------------------------MOD_ATT:N-N-------------------------+       |                                                      |                 +-----------------SUBJ:V-N-----------------+        |                                       
                |        +---------------------MOD_ATT:N-N---------------------+       |                                                      |                 +------------COMP:N-N(of)-----------+      |        |                                       
                |        |                                 +----MOD_ATT:N-N----+       |                                                      |                 +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                |        |                                 |            +MOD_AT+       +-------------APPOS-------------+              +MOD_ATT+       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                |        |                                 |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (__SP__,promoter)
MOD_ATT:N-N (__SP__,fragment)
MOD_ATT:N-N (__SP__,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 111

                                                                               +------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                                      +-------------------------------SUBJ:V-N------------------------------+                                       
                                                                               |       |                                                      +---------------------------OBJ:V-N--------------------------+        |                                       
                +--------------------------MOD_ATT:N-N-------------------------+       |                                                      |                 +-----------------SUBJ:V-N-----------------+        |                                       
                |        +---------------------MOD_ATT:N-N---------------------+       |                                                      |                 +------------COMP:N-N(of)-----------+      |        |                                       
                |        |                                 +----MOD_ATT:N-N----+       |                                                      |                 +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                |        |                                 |            +MOD_AT+       +-------------APPOS-------------+              +MOD_ATT+       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                |        |                                 |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (__SP__,promoter)
MOD_ATT:N-N (__SP__,fragment)
MOD_ATT:N-N (__SP__,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 112

                                                                               +------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                                      +-------------------------------SUBJ:V-N------------------------------+                                       
                                                                               |       |                                                      +---------------------------OBJ:V-N--------------------------+        |                                       
                +--------------------------MOD_ATT:N-N-------------------------+       |                                                      |                 +-----------------SUBJ:V-N-----------------+        |                                       
                |        +---------------------MOD_ATT:N-N---------------------+       |                                                      |                 +------------COMP:N-N(of)-----------+      |        |                                       
                |        |                                 +----MOD_ATT:N-N----+       |                                                      |                 +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                |        |                                 |            +MOD_AT+       +-------------APPOS-------------+              +MOD_ATT+       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                |        |                                 |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (__SP__,promoter)
MOD_ATT:N-N (__SP__,fragment)
MOD_ATT:N-N (__SP__,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 113

                                                                               +------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                                              +---------------------------SUBJ:V-N--------------------------+                                       
                                                                               |       |                                                              +-----------------------OBJ:V-N----------------------+        |                                       
                +--------------------------MOD_ATT:N-N-------------------------+       |                                                              |         +-----------------SUBJ:V-N-----------------+        |                                       
                |        +---------------------MOD_ATT:N-N---------------------+       |                                                              |         +------------COMP:N-N(of)-----------+      |        |                                       
                |        |                                 +----MOD_ATT:N-N----+       |                                              +--MOD_ATT:N-N--+         +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                |        |                                 |            +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+         |           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                |        |                                 |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (__SP__,promoter)
MOD_ATT:N-N (__SP__,fragment)
MOD_ATT:N-N (__SP__,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,complex)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,complex)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 114

                                          +-------------------------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------------------------+                                       
                                          |                                    +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                          |                                    |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                          |                                    |       |                                              +-----------------------------------SUBJ:V-N----------------------------------+                                       
                                          |                                    |       |                                              +-------------------------------OBJ:V-N------------------------------+        |                                       
                                          |                                    |       |                                              |                         +-----------------SUBJ:V-N-----------------+        |                                       
                                          |                                    |       |                                              |                         +------------COMP:N-N(of)-----------+      |        |                                       
                                          |                                    |       |                                              |       +---MOD_ATT:N-N---+----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              |       |       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                |        |                |                             |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,CTCAGAACATAAAGAACAGAG)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 115

                                          +-------------------------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------------------------+                                       
                                          |                                    +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                          |                                    |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                          |                                    |       |                                              +-----------------------------------SUBJ:V-N----------------------------------+                                       
                                          |                                    |       |                                              +-------------------------------OBJ:V-N------------------------------+        |                                       
                                          |                                    |       |                                              |                         +-----------------SUBJ:V-N-----------------+        |                                       
                                          |                                    |       |                                              |                         +------------COMP:N-N(of)-----------+      |        |                                       
                                          |                                    |       |                                              |       +---MOD_ATT:N-N---+----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                +MOD_ATT:+---MOD_ATT:N-N--+                             +MOD_AT+       +-------------APPOS-------------+              |       |       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                |        |                |                             |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CTCAGAACATAAAGAACAGAG,fragment)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,CTCAGAACATAAAGAACAGAG)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 116

                                                                               +------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                                      +-------------------------------SUBJ:V-N------------------------------+                                       
                                                                               |       |                                                      +---------------------------OBJ:V-N--------------------------+        |                                       
                +--------------------------MOD_ATT:N-N-------------------------+       |                                                      |                 +-----------------SUBJ:V-N-----------------+        |                                       
                |        +---------------------MOD_ATT:N-N---------------------+       |                                                      |                 +------------COMP:N-N(of)-----------+      |        |                                       
                |        |                                 +----MOD_ATT:N-N----+       |                                                      |                 +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                |        |                                 |            +MOD_AT+       +-------------APPOS-------------+              +MOD_ATT+       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                |        |                                 |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (__SP__,promoter)
MOD_ATT:N-N (__SP__,fragment)
MOD_ATT:N-N (__SP__,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 117

                                                                               +------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                                      +-------------------------------SUBJ:V-N------------------------------+                                       
                                                                               |       |                                                      +---------------------------OBJ:V-N--------------------------+        |                                       
                +--------------------------MOD_ATT:N-N-------------------------+       |                                                      |                 +-----------------SUBJ:V-N-----------------+        |                                       
                |        +---------------------MOD_ATT:N-N---------------------+       |                                                      |                 +------------COMP:N-N(of)-----------+      |        |                                       
                |        |                                 +----MOD_ATT:N-N----+       |                                                      |                 +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                |        |                                 |            +MOD_AT+       +-------------APPOS-------------+              +MOD_ATT+       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                |        |                                 |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (__SP__,promoter)
MOD_ATT:N-N (__SP__,fragment)
MOD_ATT:N-N (__SP__,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 118

                                                                               +------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                                      +-------------------------------SUBJ:V-N------------------------------+                                       
                                                                               |       |                                                      +---------------------------OBJ:V-N--------------------------+        |                                       
                +--------------------------MOD_ATT:N-N-------------------------+       |                                                      |                 +-----------------SUBJ:V-N-----------------+        |                                       
                |        +---------------------MOD_ATT:N-N---------------------+       |                                                      |                 +------------COMP:N-N(of)-----------+      |        |                                       
                |        |                                 +----MOD_ATT:N-N----+       |                                                      |                 +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                |        |                                 |            +MOD_AT+       +-------------APPOS-------------+              +MOD_ATT+       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                |        |                                 |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (__SP__,promoter)
MOD_ATT:N-N (__SP__,fragment)
MOD_ATT:N-N (__SP__,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 119

                                                                               +------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                              +-----------------------------------SUBJ:V-N----------------------------------+                                       
                                                                               |       |                                              +-------------------------------OBJ:V-N------------------------------+        |                                       
                +--------------------------MOD_ATT:N-N-------------------------+       |                                              |                         +-----------------SUBJ:V-N-----------------+        |                                       
                |        +---------------------MOD_ATT:N-N---------------------+       |                                              |                         +------------COMP:N-N(of)-----------+      |        |                                       
                |        |                                 +----MOD_ATT:N-N----+       |                                              |       +---MOD_ATT:N-N---+----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                |        |                                 |            +MOD_AT+       +-------------APPOS-------------+              |       |       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                |        |                                 |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (__SP__,promoter)
MOD_ATT:N-N (__SP__,fragment)
MOD_ATT:N-N (__SP__,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 120

                                                                               +------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                              +-----------------------------------SUBJ:V-N----------------------------------+                                       
                                                                               |       |                                              +-------------------------------OBJ:V-N------------------------------+        |                                       
                +--------------------------MOD_ATT:N-N-------------------------+       |                                              |                         +-----------------SUBJ:V-N-----------------+        |                                       
                |        +---------------------MOD_ATT:N-N---------------------+       |                                              |                         +------------COMP:N-N(of)-----------+      |        |                                       
                |        |                                 +----MOD_ATT:N-N----+       |                                              |       +---MOD_ATT:N-N---+----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                |        |                                 |            +MOD_AT+       +-------------APPOS-------------+              |       |       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                |        |                                 |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (__SP__,promoter)
MOD_ATT:N-N (__SP__,fragment)
MOD_ATT:N-N (__SP__,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 121

                                                                               +------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                                              +---------------------------SUBJ:V-N--------------------------+                                       
                                                                               |       |                                                              +-----------------------OBJ:V-N----------------------+        |                                       
                +--------------------------MOD_ATT:N-N-------------------------+       |                                                              |         +-----------------SUBJ:V-N-----------------+        |                                       
                |        +---------------------MOD_ATT:N-N---------------------+       |                                                              |         +------------COMP:N-N(of)-----------+      |        |                                       
                |        |                                 +----MOD_ATT:N-N----+       |                                              +--MOD_ATT:N-N--+         +----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                |        |                                 |            +MOD_AT+       +-------------APPOS-------------+              |       +MOD_ATT+         |           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                |        |                                 |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (__SP__,promoter)
MOD_ATT:N-N (__SP__,fragment)
MOD_ATT:N-N (__SP__,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,complex)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,complex)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 122

                                                           +----------------------------------------------------------------------COMP:V-N(of)----------------------------------------------------------------------+                                       
                                                           |                   +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                           |                   |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                           |                   |       |                                              +-----------------------------------SUBJ:V-N----------------------------------+                                       
                                                           |                   |       |                                              +-------------------------------OBJ:V-N------------------------------+        |                                       
                                                           |                   |       |                                              |                         +-----------------SUBJ:V-N-----------------+        |                                       
                                                           |                   |       |                                              |                         +------------COMP:N-N(of)-----------+      |        |                                       
                                                           |                   |       |                                              |       +---MOD_ATT:N-N---+----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                                                           |            +MOD_AT+       +-------------APPOS-------------+              |       |       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                                                           |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,@card@)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 123

                                                           +----------------------------------------------------------------------COMP:V-N(of)----------------------------------------------------------------------+                                       
                                                           |                   +-----------------------------------------------------------COMP:V-N(from)-----------------------------------------------------------+                                       
                                                           |                   |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                           |                   |       |                                              +-----------------------------------SUBJ:V-N----------------------------------+                                       
                                                           |                   |       |                                              +-------------------------------OBJ:V-N------------------------------+        |                                       
                                                           |                   |       |                                              |                         +-----------------SUBJ:V-N-----------------+        |                                       
                                                           |                   |       |                                              |                         +------------COMP:N-N(of)-----------+      |        |                                       
                                                           |                   |       |                                              |       +---MOD_ATT:N-N---+----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                                                           |            +MOD_AT+       +-------------APPOS-------------+              |       |       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                                                           |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,@card@)
COMP:V-N(from) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 124

                                                                               +------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                              +-----------------------------------SUBJ:V-N----------------------------------+                                       
                                                                               |       |                                              +-------------------------------OBJ:V-N------------------------------+        |                                       
                +--------------------------MOD_ATT:N-N-------------------------+       |                                              |                         +-----------------SUBJ:V-N-----------------+        |                                       
                |        +---------------------MOD_ATT:N-N---------------------+       |                                              |                         +------------COMP:N-N(of)-----------+      |        |                                       
                |        |                                 +----MOD_ATT:N-N----+       |                                              |       +---MOD_ATT:N-N---+----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                |        |                                 |            +MOD_AT+       +-------------APPOS-------------+              |       |       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                |        |                                 |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (__SP__,promoter)
MOD_ATT:N-N (__SP__,fragment)
MOD_ATT:N-N (__SP__,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 125

                                                                               +------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                              +-----------------------------------SUBJ:V-N----------------------------------+                                       
                                                                               |       |                                              +-------------------------------OBJ:V-N------------------------------+        |                                       
                +--------------------------MOD_ATT:N-N-------------------------+       |                                              |                         +-----------------SUBJ:V-N-----------------+        |                                       
                |        +---------------------MOD_ATT:N-N---------------------+       |                                              |                         +------------COMP:N-N(of)-----------+      |        |                                       
                |        |                                 +----MOD_ATT:N-N----+       |                                              |       +---MOD_ATT:N-N---+----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                |        |                                 |            +MOD_AT+       +-------------APPOS-------------+              |       |       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                |        |                                 |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (__SP__,promoter)
MOD_ATT:N-N (__SP__,fragment)
MOD_ATT:N-N (__SP__,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 126

                                                                               +------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                              +-----------------------------------SUBJ:V-N----------------------------------+                                       
                                                                               |       |                                              +-------------------------------OBJ:V-N------------------------------+        |                                       
                +--------------------------MOD_ATT:N-N-------------------------+       |                                              |                         +-----------------SUBJ:V-N-----------------+        |                                       
                |        +---------------------MOD_ATT:N-N---------------------+       |                                              |                         +------------COMP:N-N(of)-----------+      |        |                                       
                |        |                                 +----MOD_ATT:N-N----+       |                                              |       +---MOD_ATT:N-N---+----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                |        |                                 |            +MOD_AT+       +-------------APPOS-------------+              |       |       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                |        |                                 |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (__SP__,promoter)
MOD_ATT:N-N (__SP__,fragment)
MOD_ATT:N-N (__SP__,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)

Analyse 127

                                                                               +------------------------------------------------------------COMP:V-N(of)------------------------------------------------------------+                                       
                                                                               |       +----------------------------------------------------------SUBJ:V-N----------------------------------------------------------+                                       
                                                                               |       |                                              +-----------------------------------SUBJ:V-N----------------------------------+                                       
                                                                               |       |                                              +-------------------------------OBJ:V-N------------------------------+        |                                       
                +--------------------------MOD_ATT:N-N-------------------------+       |                                              |                         +-----------------SUBJ:V-N-----------------+        |                                       
                |        +---------------------MOD_ATT:N-N---------------------+       |                                              |                         +------------COMP:N-N(of)-----------+      |        |                                       
                |        |                                 +----MOD_ATT:N-N----+       |                                              |       +---MOD_ATT:N-N---+----COMP:N-N(of)---+               |      |        |           +----COMP:N-N(of)----+      
                |        |                                 |            +MOD_AT+       +-------------APPOS-------------+              |       |       +MOD_ATT:N+           +MOD_ATT+               |      |        +COMP:V-N(in+          +MOD_ATT:N+      
                |        |                                 |            |      |       |                               |              |       |       |         |           |       |               |      |        |           |          |         |      
 Binding of promoter fragment ( CTCAGAACATAAAGAACAGAG 441 421 ) from mutant __SP__ __NODE__ gene ( G426A T427A T435A G436A ) and a protein protein complex consisting of __SP__ __NODE__ and of __NODE__ does not occur in a system of purified components .
MOD_ATT:N-N (__SP__,promoter)
MOD_ATT:N-N (__SP__,fragment)
MOD_ATT:N-N (__SP__,@card@)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,G436A)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (do,protein)
SUBJ:V-N (do,consist)
COMP:V-N(of) (occur,__SP__)
SUBJ:V-N (occur,__NODE__)
SUBJ:V-N (occur,protein)
COMP:V-N(in) (occur,system)
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)