Validation pour Ingenuity025

vers la météo de la validation par utilisateur

Ingenuity025

precedent - 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 - suivant

Phrase 47 - PMID ?

Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog NODE and of mutant SP NODE ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .

Non annotée
Je ne sais pas
Je n'ai pas trouvé d'analyse satisfaisante

Commentaires :

Analyse 0

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                                                               +--------------------------------COMP:V-N(with)--------------------------------+                       |                          
                                                                                  +-----------------------OBJ:V-N-----------------------+         |                 +-----------------COMP:N-N(of)----------------+              |                       |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                 |              +---------MOD_ATT:N-ADJ--------+              |                       +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+              |                       |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 1

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +-----------------------OBJ:V-N-----------------------+                           +-----------------COMP:N-N(of)----------------+                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                 |              +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 2

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                                      |                          
                                                                                  +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                                +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,G?V)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 3

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                                                               +--------------------------------COMP:V-N(with)--------------------------------+                       |                          
                                                                                  +-----------------------OBJ:V-N-----------------------+         +--------------------------COMP:N-N(of)-------------------------+              |                       |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                                +---------MOD_ATT:N-ADJ--------+              |                       +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+              |                       |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 4

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                                      |                          
                                                                                  +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+-----------------------COMP:N-N(of)----------------------+              +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 5

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                                      |                          
                                                                                  +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+-----------------------COMP:N-N(of)----------------------+              +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 6

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+                             |                                          +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,G?V)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 7

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +------------------------------------------------------------OBJ:V-N------------------------------------------------------------+                                      |                          
                                                                                  +-----------------------OBJ:V-N-----------------------+                                                                         |                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+                             |                                          +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
OBJ:V-N (contain,G?V)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 8

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+                             |                                          +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 9

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                                                               +--------------------------------COMP:V-N(with)--------------------------------+                       |                          
                                                                                  +-----------------------OBJ:V-N-----------------------+         |                 +-----------------COMP:N-N(of)----------------+              |                       |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+                             |         |                 |              +---------MOD_ATT:N-ADJ--------+              |                       +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+              |                       |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 10

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                                                               +--------------------------------COMP:V-N(with)--------------------------------+                       |                          
                                                                                  +-----------------------OBJ:V-N-----------------------+         +--------------------------COMP:N-N(of)-------------------------+              |                       |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+                             |         |                                +---------MOD_ATT:N-ADJ--------+              |                       +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+              |                       |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 11

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                                      |                          
                                                                                  +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                                                               |                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,G?V)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 12

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +-----------------------OBJ:V-N-----------------------+                           +-----------------COMP:N-N(of)----------------+                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                 |              +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+                  +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |                  |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 13

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +-----------------------OBJ:V-N-----------------------+         +--------------------------------COMP:V-N(with)--------------------------------+                       |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+--------------------------COMP:N-N(of)-------------------------+              |                       +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |              |                       |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 14

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +-----------------------OBJ:V-N-----------------------+                                                                                                                |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+--------------------------COMP:N-N(of)-------------------------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 15

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                                      |                          
                                                                                  +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+-----------------------COMP:N-N(of)----------------------+                                             |                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              +-MOD_ATT:N-ADJ+               |                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 16

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                                      |                          
                                                                                  +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+-----------------------COMP:N-N(of)----------------------+                                             |                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              +-MOD_ATT:N-ADJ+               |                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 17

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                                      |                          
                                                                                  +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+-----------------------COMP:N-N(of)----------------------+              +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+                  +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |                  |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 18

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                                      |                          
                                                                                  +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+-----------------------COMP:N-N(of)----------------------+              +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+                  +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |                  |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 19

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +-----------------------OBJ:V-N-----------------------+                                                                                                                |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+                             |                           +-----------------COMP:N-N(of)----------------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 20

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +-----------------------OBJ:V-N-----------------------+                                                                                                                |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+                             +-------------------------------COMP:N-N(of)------------------------------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,G?V)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 21

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +-----------------------OBJ:V-N-----------------------+                           +-----------------COMP:N-N(of)----------------+                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+                             |                           |              +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+                  +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |                  |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 22

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+                             |                                          +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+                  +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |                  |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,G?V)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 23

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +------------------------------------------------------------OBJ:V-N------------------------------------------------------------+                                      |                          
                                                                                  +-----------------------OBJ:V-N-----------------------+                                                                         |                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+                             |                                          +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+                  +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |                  |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
OBJ:V-N (contain,G?V)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 24

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +-----------------------OBJ:V-N-----------------------+                                                                                                                |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+                             |         +--------------------------COMP:N-N(of)-------------------------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 25

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+                             |                                          +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+                  +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |                  |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 26

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +-----------------------OBJ:V-N-----------------------+         +--------------------------------COMP:V-N(with)--------------------------------+                       |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+                             |         |                 +-----------------COMP:N-N(of)----------------+              |                       +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |              |                       |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 27

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                                                                                 +-----------------------COMP:N-N(with)-----------------------+                       |                          
                                                                                  +-----------------------OBJ:V-N-----------------------+                           +-----------------COMP:N-N(of)----------------+              |                       |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+                             |                           |              +---------MOD_ATT:N-ADJ--------+              |                       +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+              |                       |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
COMP:N-N(with) (__NODE__,box)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 28

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                                                               +--------------------------------COMP:V-N(with)--------------------------------+                       |                          
                                                                                  +-----------------------OBJ:V-N-----------------------+         |                 +-----------------COMP:N-N(of)----------------+              |                       |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+                             |         |                 |              +---------MOD_ATT:N-ADJ--------+              |                       +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+              |                       |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+                  +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |                  |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 29

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                                                               +--------------------------------COMP:V-N(with)--------------------------------+              |        |                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+         |                 +-----------------COMP:N-N(of)----------------+              |              |        |                          
                             |                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                 |              +---------MOD_ATT:N-ADJ--------+              |              |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+              |              |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 30

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +-----------------------OBJ:V-N-----------------------+                           +-----------------------COMP:N-N(with)-----------------------+                       |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                 +-----------------COMP:N-N(of)----------------+              |                       +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |              |                       |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
COMP:N-N(with) (__NODE__,box)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 31

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +-----------------------OBJ:V-N-----------------------+         +--------------------------------COMP:V-N(with)--------------------------------+                       |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                 +-----------------COMP:N-N(of)----------------+              |                       +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |              |                       |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+                  +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |                  |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 32

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +-----------------------OBJ:V-N-----------------------+                                                                                                                |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                 +-----------------COMP:N-N(of)----------------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+                  +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |                  |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 33

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+                           +-----------------COMP:N-N(of)----------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                 |              +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 34

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                                +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,G?V)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 35

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+         +--------------------------COMP:N-N(of)-------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                                +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 36

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                                      |                          
                                                                                  +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+-----------------------COMP:N-N(of)----------------------+                                             |                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              +-MOD_ATT:N-ADJ+               |                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+                  +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |                  |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 37

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+-----------------------COMP:N-N(of)----------------------+              +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 38

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+-----------------------COMP:N-N(of)----------------------+              +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 39

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+                           +-----------------COMP:N-N(of)----------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |                           |              +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 40

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |                                          +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,G?V)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 41

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +------------------------------------------------------------OBJ:V-N------------------------------------------------------------+                                      |                          
                                                                                  +-----------------------OBJ:V-N-----------------------+                                                                         |                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+                             |                                                                         |                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+                  +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |                  |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
OBJ:V-N (contain,G?V)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 42

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +------------------------------------------------------------OBJ:V-N------------------------------------------------------------+                             |        |                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+                                                                         |                             |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |                                          +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
OBJ:V-N (contain,G?V)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 43

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+         +--------------------------COMP:N-N(of)-------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |         |                                +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 44

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +-----------------------OBJ:V-N-----------------------+                                                                                                                |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+                             +-------------------------------COMP:N-N(of)------------------------------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              +-MOD_ATT:N-ADJ+               |                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+                  +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |                  |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 45

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +-----------------------OBJ:V-N-----------------------+                                                                                                                |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+                             +-------------------------------COMP:N-N(of)------------------------------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              +-MOD_ATT:N-ADJ+               |                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+                  +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |                  |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 46

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +-----------------------OBJ:V-N-----------------------+                           +-----------------------COMP:N-N(with)-----------------------+                       |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+                             |                           +-----------------COMP:N-N(of)----------------+              |                       +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |              |                       |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
COMP:N-N(with) (__NODE__,box)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 47

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +-----------------------OBJ:V-N-----------------------+         +--------------------------------COMP:V-N(with)--------------------------------+                       |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+                             |         |                 +-----------------COMP:N-N(of)----------------+              |                       +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |              |                       |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+                  +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |                  |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 48

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                                                               +--------------------------------COMP:V-N(with)--------------------------------+              |        |                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+         +--------------------------COMP:N-N(of)-------------------------+              |              |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |         |                                +---------MOD_ATT:N-ADJ--------+              |              |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+              |              |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 49

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+         +--------------------------------COMP:V-N(with)--------------------------------+              |        |                          
                             |                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                 +-----------------COMP:N-N(of)----------------+              |              |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |              |              |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 50

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                                                                                 +-----------------------COMP:N-N(with)-----------------------+              |        |                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+                           +-----------------COMP:N-N(of)----------------+              |              |        |                          
                             |                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                 |              +---------MOD_ATT:N-ADJ--------+              |              |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+              |              |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
COMP:N-N(with) (__NODE__,box)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 51

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+                                                                                                       |        |                          
                             |                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                 +-----------------COMP:N-N(of)----------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 52

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                                                               |                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,G?V)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 53

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                                                               +--------------------------------COMP:V-N(with)--------------------------------+              |        |                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+         |                 +-----------------COMP:N-N(of)----------------+              |              |        |                          
                             |                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                 |              +---------MOD_ATT:N-ADJ--------+              |              |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+              |              |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 54

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                                +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,G?V)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 55

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+                           +-----------------COMP:N-N(of)----------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                 |              +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 56

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+         +--------------------------------COMP:V-N(with)--------------------------------+              |        |                          
                             |                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+--------------------------COMP:N-N(of)-------------------------+              |              |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |              |              |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 57

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                                                               +--------------------------------COMP:V-N(with)--------------------------------+              |        |                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+         +--------------------------COMP:N-N(of)-------------------------+              |              |        |                          
                             |                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                                +---------MOD_ATT:N-ADJ--------+              |              |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+              |              |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 58

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+                                                                                                       |        |                          
                             |                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+--------------------------COMP:N-N(of)-------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 59

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+         +--------------------------COMP:N-N(of)-------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                                +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 60

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+-----------------------COMP:N-N(of)----------------------+                                             |                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 61

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+-----------------------COMP:N-N(of)----------------------+              +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 62

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+-----------------------COMP:N-N(of)----------------------+              +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 63

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+                                                                                                       |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |                           +-----------------COMP:N-N(of)----------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 64

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+                                                                                                       |        |                          
                             |                                                    +--------OBJ:V-N--------+                             +-------------------------------COMP:N-N(of)------------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,G?V)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 65

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+                           +-----------------COMP:N-N(of)----------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |                           |              +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 66

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |                                          +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,G?V)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 67

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +------------------------------------------------------------OBJ:V-N------------------------------------------------------------+                             |        |                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+                                                                         |                             |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |                                                                         |                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
OBJ:V-N (contain,G?V)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 68

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+                                                                                                       |        |                          
                             |                                                    +--------OBJ:V-N--------+                             +-------------------------------COMP:N-N(of)------------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 69

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+                                                                                                       |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |         +--------------------------COMP:N-N(of)-------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 70

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+                                                                                                       |        |                          
                             |                                                    +--------OBJ:V-N--------+                             +-------------------------------COMP:N-N(of)------------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 71

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |                                          +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 72

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+         +--------------------------COMP:N-N(of)-------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |         |                                +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 73

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |                                          +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 74

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |                                          +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 75

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+         +--------------------------------COMP:V-N(with)--------------------------------+              |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |         |                 +-----------------COMP:N-N(of)----------------+              |              |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |              |              |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 76

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+         +--------------------------------COMP:V-N(with)--------------------------------+              |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |         +--------------------------COMP:N-N(of)-------------------------+              |              |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |              |              |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 77

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                                                               +--------------------------------COMP:V-N(with)--------------------------------+              |        |                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+         +--------------------------COMP:N-N(of)-------------------------+              |              |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |         |                                +---------MOD_ATT:N-ADJ--------+              |              |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+              |              |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 78

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                                                               +--------------------------------COMP:V-N(with)--------------------------------+              |        |                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+         +--------------------------COMP:N-N(of)-------------------------+              |              |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |         |                                +---------MOD_ATT:N-ADJ--------+              |              |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+              |              |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 79

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+                           +-----------------------COMP:N-N(with)-----------------------+              |        |                          
                             |                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                 +-----------------COMP:N-N(of)----------------+              |              |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |              |              |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
COMP:N-N(with) (__NODE__,box)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 80

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+         +--------------------------------COMP:V-N(with)--------------------------------+              |        |                          
                             |                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                 +-----------------COMP:N-N(of)----------------+              |              |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |              |              |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 81

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                                                               |                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,G?V)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 82

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+                                                                                                       |        |                          
                             |                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                 +-----------------COMP:N-N(of)----------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 83

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                                                               |                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,G?V)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 84

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+         +--------------------------------COMP:V-N(with)--------------------------------+              |        |                          
                             |                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+--------------------------COMP:N-N(of)-------------------------+              |              |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |              |              |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 85

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+         +--------------------------------COMP:V-N(with)--------------------------------+              |        |                          
                             |                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+--------------------------COMP:N-N(of)-------------------------+              |              |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |              |              |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 86

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+                                                                                                       |        |                          
                             |                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+--------------------------COMP:N-N(of)-------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 87

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+-----------------------COMP:N-N(of)----------------------+                                             |                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 88

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+-----------------------COMP:N-N(of)----------------------+                                             |                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 89

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                                      |                          
                                                                                  +----------------------------OBJ:V-N----------------------------+--------------------------COMP:N-N(of)-------------------------+                                      |                          
                                                                                  |                       +-----------------------COMP:N-N(of)----------------------+                                             |                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+                 |              +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 90

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+                                                                                                       |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |                           +-----------------COMP:N-N(of)----------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 91

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+                                                                                                       |        |                          
                             |                                                    +--------OBJ:V-N--------+                             +-------------------------------COMP:N-N(of)------------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,G?V)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 92

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +------------------------------------------------------------OBJ:V-N------------------------------------------------------------+                             |        |                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+                                                                         |                             |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |                                                                         |                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
OBJ:V-N (contain,G?V)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 93

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+                                                                                                       |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |         +--------------------------COMP:N-N(of)-------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 94

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+                                                                                                       |        |                          
                             |                                                    +--------OBJ:V-N--------+                             +-------------------------------COMP:N-N(of)------------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 95

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +----------------------------OBJ:V-N----------------------------+--------------------------COMP:N-N(of)-------------------------+                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+                                +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 96

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+                           +-----------------------COMP:N-N(with)-----------------------+              |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |                           +-----------------COMP:N-N(of)----------------+              |              |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |              |              |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
COMP:N-N(with) (__NODE__,box)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 97

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+         +--------------------------------COMP:V-N(with)--------------------------------+              |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |         |                 +-----------------COMP:N-N(of)----------------+              |              |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |              |              |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 98

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+         +--------------------------------COMP:V-N(with)--------------------------------+              |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |         +--------------------------COMP:N-N(of)-------------------------+              |              |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |              |              |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 99

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                                      |                          
                                                                                  +----------------------------OBJ:V-N----------------------------+                                                               |                                      |                          
                                                                                  |                       +-----------------------COMP:N-N(of)----------------------+                                             |                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 100

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                                      |                          
                                                                                  +----------------------------OBJ:V-N----------------------------+--------------------------COMP:N-N(of)-------------------------+                                      |                          
                                                                                  |                       +-----------------------COMP:N-N(of)----------------------+                                             |                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+                 |              +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+                  +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |                  |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 101

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                                      |                          
                                                                                  +----------------------------OBJ:V-N----------------------------+--------------------------COMP:N-N(of)-------------------------+                                      |                          
                                                                                  |                       +-----------------------COMP:N-N(of)----------------------+                                             |                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+                 |              +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+                  +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |                  |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 102

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +----------------------------OBJ:V-N----------------------------+                                                                                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 103

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +----------------------------OBJ:V-N----------------------------+--------------------------COMP:N-N(of)-------------------------+                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+                                +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+                  +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |                  |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 104

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+--------------------------COMP:N-N(of)-------------------------+                             |        |                          
                             |                                                    |                       +-----------------------COMP:N-N(of)----------------------+                                             |                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+                 |              +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 105

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                                      |                          
                                                                                  +----------------------------OBJ:V-N----------------------------+                                                               |                                      |                          
                                                                                  |                       +-----------------------COMP:N-N(of)----------------------+                                             |                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+                  +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |                  |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 106

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+--------------------------COMP:N-N(of)-------------------------+                             |        |                          
                             |                                                    |                       +-----------------------COMP:N-N(of)----------------------+                                             |                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+                 |              +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 107

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                                      |                          
                                                                                  +----------------------------OBJ:V-N----------------------------+--------------------------COMP:N-N(of)-------------------------+                                      |                          
                                                                                  |                       +-----------------------COMP:N-N(of)----------------------+                                             |                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+                 |              +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 108

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                                      |                          
                                                                                  +----------------------------OBJ:V-N----------------------------+--------------------------COMP:N-N(of)-------------------------+                                      |                          
                                                                                  |                       +-----------------------COMP:N-N(of)----------------------+                                             |                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+                 |              +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 109

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+--------------------------COMP:N-N(of)-------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+                                +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 110

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+--------------------------COMP:N-N(of)-------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+                                +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 111

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +----------------------------OBJ:V-N----------------------------+--------------------------COMP:N-N(of)-------------------------+                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+                                +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 112

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+                                                               |                             |        |                          
                             |                                                    |                       +-----------------------COMP:N-N(of)----------------------+                                             |                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 113

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                                      |                          
                                                                                  +----------------------------OBJ:V-N----------------------------+                                                               |                                      |                          
                                                                                  |                       +-----------------------COMP:N-N(of)----------------------+                                             |                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 114

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                                      |                          
                                                                                  +----------------------------OBJ:V-N----------------------------+                                                               |                                      |                          
                                                                                  |                       +-----------------------COMP:N-N(of)----------------------+                                             |                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 115

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+--------------------------COMP:N-N(of)-------------------------+                             |        |                          
                             |                                                    |                       +-----------------------COMP:N-N(of)----------------------+                                             |                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+                 |              +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 116

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                                      |                          
                                                                                  +----------------------------OBJ:V-N----------------------------+--------------------------COMP:N-N(of)-------------------------+                                      |                          
                                                                                  |                       +-----------------------COMP:N-N(of)----------------------+                                             |                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+                 |              +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+                  +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |                  |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 117

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+                                                                                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 118

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+                                                                                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 119

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +----------------------------OBJ:V-N----------------------------+                                                                                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 120

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+--------------------------COMP:N-N(of)-------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+                                +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 121

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+--------------------------COMP:N-N(of)-------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+                                +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 122

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +----------------------------OBJ:V-N----------------------------+--------------------------COMP:N-N(of)-------------------------+                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+                                +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+                  +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |                  |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 123

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+                                                               |                             |        |                          
                             |                                                    |                       +-----------------------COMP:N-N(of)----------------------+                                             |                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 124

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+                                                               |                             |        |                          
                             |                                                    |                       +-----------------------COMP:N-N(of)----------------------+                                             |                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 125

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                                      |                          
                                                                                  +----------------------------OBJ:V-N----------------------------+                                                               |                                      |                          
                                                                                  |                       +-----------------------COMP:N-N(of)----------------------+                                             |                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+                  +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |                  |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 126

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+--------------------------COMP:N-N(of)-------------------------+                             |        |                          
                             |                                                    |                       +-----------------------COMP:N-N(of)----------------------+                                             |                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+                 |              +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 127

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+                                                                                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 128

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+                                                                                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 129

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+                                                                                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 130

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +----------------------------OBJ:V-N----------------------------+                                                                                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+                  +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |                  |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 131

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+--------------------------COMP:N-N(of)-------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+                                +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 132

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+--------------------------COMP:N-N(of)-------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+                                +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 133

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+                                                               |                             |        |                          
                             |                                                    |                       +-----------------------COMP:N-N(of)----------------------+                                             |                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 134

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+                                                               |                             |        |                          
                             |                                                    |                       +-----------------------COMP:N-N(of)----------------------+                                             |                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 135

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+--------------------------COMP:N-N(of)-------------------------+                             |        |                          
                             |                                                    |                       +-----------------------COMP:N-N(of)----------------------+                                             |                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+                 |              +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 136

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+                                                                                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 137

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+                                                                                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 138

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+--------------------------COMP:N-N(of)-------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+                                +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 139

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+--------------------------COMP:N-N(of)-------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+                                +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 140

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+                                                               |                             |        |                          
                             |                                                    |                       +-----------------------COMP:N-N(of)----------------------+                                             |                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 141

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+                                                               |                             |        |                          
                             |                                                    |                       +-----------------------COMP:N-N(of)----------------------+                                             |                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 142

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+                                                                                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

Analyse 143

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+                                                                                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)