Validation pour Ingenuity025

vers la météo de la validation par utilisateur

Ingenuity025

precedent - 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 - suivant

Phrase 47 - PMID ?

Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog NODE and of mutant SP NODE ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .

name="reponse" value="NA"> Non annotée
name="reponse" value="JSP"> Je ne sais pas
name="reponse" value="INS"> Je n'ai pas trouvé d'analyse satisfaisante

Commentaires :

<?php echo $Com ; ?>

name="reponse" value="A0">Analyse 0

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                                                               +--------------------------------COMP:V-N(with)--------------------------------+                       |                          
                                                                                  +-----------------------OBJ:V-N-----------------------+         |                 +-----------------COMP:N-N(of)----------------+              |                       |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                 |              +---------MOD_ATT:N-ADJ--------+              |                       +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+              |                       |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A1">Analyse 1

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +-----------------------OBJ:V-N-----------------------+                           +-----------------COMP:N-N(of)----------------+                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                 |              +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A2">Analyse 2

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                                      |                          
                                                                                  +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                                +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,G?V)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A3">Analyse 3

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                                                               +--------------------------------COMP:V-N(with)--------------------------------+                       |                          
                                                                                  +-----------------------OBJ:V-N-----------------------+         +--------------------------COMP:N-N(of)-------------------------+              |                       |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                                +---------MOD_ATT:N-ADJ--------+              |                       +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+              |                       |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A4">Analyse 4

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                                      |                          
                                                                                  +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+-----------------------COMP:N-N(of)----------------------+              +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A5">Analyse 5

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                                      |                          
                                                                                  +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+-----------------------COMP:N-N(of)----------------------+              +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A6">Analyse 6

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+                             |                                          +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,G?V)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A7">Analyse 7

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +------------------------------------------------------------OBJ:V-N------------------------------------------------------------+                                      |                          
                                                                                  +-----------------------OBJ:V-N-----------------------+                                                                         |                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+                             |                                          +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
OBJ:V-N (contain,G?V)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A8">Analyse 8

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+                             |                                          +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A9">Analyse 9

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                                                               +--------------------------------COMP:V-N(with)--------------------------------+                       |                          
                                                                                  +-----------------------OBJ:V-N-----------------------+         |                 +-----------------COMP:N-N(of)----------------+              |                       |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+                             |         |                 |              +---------MOD_ATT:N-ADJ--------+              |                       +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+              |                       |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A10">Analyse 10

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                                                               +--------------------------------COMP:V-N(with)--------------------------------+                       |                          
                                                                                  +-----------------------OBJ:V-N-----------------------+         +--------------------------COMP:N-N(of)-------------------------+              |                       |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+                             |         |                                +---------MOD_ATT:N-ADJ--------+              |                       +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+              |                       |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A11">Analyse 11

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                                      |                          
                                                                                  +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                                                               |                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,G?V)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A12">Analyse 12

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +-----------------------OBJ:V-N-----------------------+                           +-----------------COMP:N-N(of)----------------+                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                 |              +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+                  +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |                  |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A13">Analyse 13

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +-----------------------OBJ:V-N-----------------------+         +--------------------------------COMP:V-N(with)--------------------------------+                       |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+--------------------------COMP:N-N(of)-------------------------+              |                       +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |              |                       |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A14">Analyse 14

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +-----------------------OBJ:V-N-----------------------+                                                                                                                |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+--------------------------COMP:N-N(of)-------------------------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A15">Analyse 15

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                                      |                          
                                                                                  +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+-----------------------COMP:N-N(of)----------------------+                                             |                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              +-MOD_ATT:N-ADJ+               |                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A16">Analyse 16

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                                      |                          
                                                                                  +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+-----------------------COMP:N-N(of)----------------------+                                             |                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              +-MOD_ATT:N-ADJ+               |                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A17">Analyse 17

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                                      |                          
                                                                                  +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+-----------------------COMP:N-N(of)----------------------+              +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+                  +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |                  |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A18">Analyse 18

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                                      |                          
                                                                                  +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+-----------------------COMP:N-N(of)----------------------+              +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+                  +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |                  |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A19">Analyse 19

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +-----------------------OBJ:V-N-----------------------+                                                                                                                |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+                             |                           +-----------------COMP:N-N(of)----------------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A20">Analyse 20

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +-----------------------OBJ:V-N-----------------------+                                                                                                                |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+                             +-------------------------------COMP:N-N(of)------------------------------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,G?V)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A21">Analyse 21

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +-----------------------OBJ:V-N-----------------------+                           +-----------------COMP:N-N(of)----------------+                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+                             |                           |              +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+                  +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |                  |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A22">Analyse 22

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+                             |                                          +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+                  +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |                  |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,G?V)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A23">Analyse 23

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +------------------------------------------------------------OBJ:V-N------------------------------------------------------------+                                      |                          
                                                                                  +-----------------------OBJ:V-N-----------------------+                                                                         |                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+                             |                                          +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+                  +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |                  |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
OBJ:V-N (contain,G?V)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A24">Analyse 24

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +-----------------------OBJ:V-N-----------------------+                                                                                                                |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+                             |         +--------------------------COMP:N-N(of)-------------------------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A25">Analyse 25

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+                             |                                          +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+                  +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |                  |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A26">Analyse 26

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +-----------------------OBJ:V-N-----------------------+         +--------------------------------COMP:V-N(with)--------------------------------+                       |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+                             |         |                 +-----------------COMP:N-N(of)----------------+              |                       +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |              |                       |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A27">Analyse 27

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                                                                                 +-----------------------COMP:N-N(with)-----------------------+                       |                          
                                                                                  +-----------------------OBJ:V-N-----------------------+                           +-----------------COMP:N-N(of)----------------+              |                       |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+                             |                           |              +---------MOD_ATT:N-ADJ--------+              |                       +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+              |                       |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
COMP:N-N(with) (__NODE__,box)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A28">Analyse 28

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                                                               +--------------------------------COMP:V-N(with)--------------------------------+                       |                          
                                                                                  +-----------------------OBJ:V-N-----------------------+         |                 +-----------------COMP:N-N(of)----------------+              |                       |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+                             |         |                 |              +---------MOD_ATT:N-ADJ--------+              |                       +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+              |                       |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+                  +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |                  |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A29">Analyse 29

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                                                               +--------------------------------COMP:V-N(with)--------------------------------+              |        |                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+         |                 +-----------------COMP:N-N(of)----------------+              |              |        |                          
                             |                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                 |              +---------MOD_ATT:N-ADJ--------+              |              |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+              |              |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A30">Analyse 30

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +-----------------------OBJ:V-N-----------------------+                           +-----------------------COMP:N-N(with)-----------------------+                       |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                 +-----------------COMP:N-N(of)----------------+              |                       +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |              |                       |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
COMP:N-N(with) (__NODE__,box)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A31">Analyse 31

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +-----------------------OBJ:V-N-----------------------+         +--------------------------------COMP:V-N(with)--------------------------------+                       |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                 +-----------------COMP:N-N(of)----------------+              |                       +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |              |                       |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+                  +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |                  |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A32">Analyse 32

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +-----------------------OBJ:V-N-----------------------+                                                                                                                |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                 +-----------------COMP:N-N(of)----------------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+                  +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |                  |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A33">Analyse 33

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+                           +-----------------COMP:N-N(of)----------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                 |              +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A34">Analyse 34

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                                +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,G?V)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A35">Analyse 35

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+         +--------------------------COMP:N-N(of)-------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                                +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A36">Analyse 36

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                                      |                          
                                                                                  +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+-----------------------COMP:N-N(of)----------------------+                                             |                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              +-MOD_ATT:N-ADJ+               |                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+                  +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |                  |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A37">Analyse 37

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+-----------------------COMP:N-N(of)----------------------+              +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A38">Analyse 38

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+-----------------------COMP:N-N(of)----------------------+              +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A39">Analyse 39

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+                           +-----------------COMP:N-N(of)----------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |                           |              +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A40">Analyse 40

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |                                          +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,G?V)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A41">Analyse 41

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +------------------------------------------------------------OBJ:V-N------------------------------------------------------------+                                      |                          
                                                                                  +-----------------------OBJ:V-N-----------------------+                                                                         |                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+                             |                                                                         |                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+                  +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |                  |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
OBJ:V-N (contain,G?V)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A42">Analyse 42

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +------------------------------------------------------------OBJ:V-N------------------------------------------------------------+                             |        |                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+                                                                         |                             |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |                                          +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
OBJ:V-N (contain,G?V)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A43">Analyse 43

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+         +--------------------------COMP:N-N(of)-------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |         |                                +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A44">Analyse 44

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +-----------------------OBJ:V-N-----------------------+                                                                                                                |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+                             +-------------------------------COMP:N-N(of)------------------------------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              +-MOD_ATT:N-ADJ+               |                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+                  +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |                  |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A45">Analyse 45

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +-----------------------OBJ:V-N-----------------------+                                                                                                                |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+                             +-------------------------------COMP:N-N(of)------------------------------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              +-MOD_ATT:N-ADJ+               |                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+                  +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |                  |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A46">Analyse 46

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +-----------------------OBJ:V-N-----------------------+                           +-----------------------COMP:N-N(with)-----------------------+                       |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+                             |                           +-----------------COMP:N-N(of)----------------+              |                       +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |              |                       |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
COMP:N-N(with) (__NODE__,box)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A47">Analyse 47

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +-----------------------OBJ:V-N-----------------------+         +--------------------------------COMP:V-N(with)--------------------------------+                       |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+                             |         |                 +-----------------COMP:N-N(of)----------------+              |                       +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |              |                       |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+                  +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |                  |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A48">Analyse 48

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                                                               +--------------------------------COMP:V-N(with)--------------------------------+              |        |                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+         +--------------------------COMP:N-N(of)-------------------------+              |              |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |         |                                +---------MOD_ATT:N-ADJ--------+              |              |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+              |              |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A49">Analyse 49

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+         +--------------------------------COMP:V-N(with)--------------------------------+              |        |                          
                             |                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                 +-----------------COMP:N-N(of)----------------+              |              |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |              |              |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A50">Analyse 50

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                                                                                 +-----------------------COMP:N-N(with)-----------------------+              |        |                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+                           +-----------------COMP:N-N(of)----------------+              |              |        |                          
                             |                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                 |              +---------MOD_ATT:N-ADJ--------+              |              |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+              |              |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
COMP:N-N(with) (__NODE__,box)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A51">Analyse 51

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+                                                                                                       |        |                          
                             |                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                 +-----------------COMP:N-N(of)----------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A52">Analyse 52

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                                                               |                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,G?V)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A53">Analyse 53

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                                                               +--------------------------------COMP:V-N(with)--------------------------------+              |        |                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+         |                 +-----------------COMP:N-N(of)----------------+              |              |        |                          
                             |                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                 |              +---------MOD_ATT:N-ADJ--------+              |              |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+              |              |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A54">Analyse 54

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                                +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,G?V)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A55">Analyse 55

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+                           +-----------------COMP:N-N(of)----------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                 |              +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A56">Analyse 56

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+         +--------------------------------COMP:V-N(with)--------------------------------+              |        |                          
                             |                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+--------------------------COMP:N-N(of)-------------------------+              |              |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |              |              |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A57">Analyse 57

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                                                               +--------------------------------COMP:V-N(with)--------------------------------+              |        |                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+         +--------------------------COMP:N-N(of)-------------------------+              |              |        |                          
                             |                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                                +---------MOD_ATT:N-ADJ--------+              |              |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+              |              |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A58">Analyse 58

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+                                                                                                       |        |                          
                             |                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+--------------------------COMP:N-N(of)-------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A59">Analyse 59

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+         +--------------------------COMP:N-N(of)-------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                                +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A60">Analyse 60

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+-----------------------COMP:N-N(of)----------------------+                                             |                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A61">Analyse 61

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+-----------------------COMP:N-N(of)----------------------+              +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A62">Analyse 62

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+-----------------------COMP:N-N(of)----------------------+              +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A63">Analyse 63

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+                                                                                                       |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |                           +-----------------COMP:N-N(of)----------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A64">Analyse 64

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+                                                                                                       |        |                          
                             |                                                    +--------OBJ:V-N--------+                             +-------------------------------COMP:N-N(of)------------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,G?V)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A65">Analyse 65

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+                           +-----------------COMP:N-N(of)----------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |                           |              +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A66">Analyse 66

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |                                          +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,G?V)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A67">Analyse 67

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +------------------------------------------------------------OBJ:V-N------------------------------------------------------------+                             |        |                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+                                                                         |                             |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |                                                                         |                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
OBJ:V-N (contain,G?V)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A68">Analyse 68

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+                                                                                                       |        |                          
                             |                                                    +--------OBJ:V-N--------+                             +-------------------------------COMP:N-N(of)------------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A69">Analyse 69

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+                                                                                                       |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |         +--------------------------COMP:N-N(of)-------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A70">Analyse 70

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+                                                                                                       |        |                          
                             |                                                    +--------OBJ:V-N--------+                             +-------------------------------COMP:N-N(of)------------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A71">Analyse 71

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |                                          +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A72">Analyse 72

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+         +--------------------------COMP:N-N(of)-------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |         |                                +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A73">Analyse 73

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |                                          +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A74">Analyse 74

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |                                          +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A75">Analyse 75

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+         +--------------------------------COMP:V-N(with)--------------------------------+              |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |         |                 +-----------------COMP:N-N(of)----------------+              |              |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |              |              |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A76">Analyse 76

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+         +--------------------------------COMP:V-N(with)--------------------------------+              |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |         +--------------------------COMP:N-N(of)-------------------------+              |              |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |              |              |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A77">Analyse 77

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                                                               +--------------------------------COMP:V-N(with)--------------------------------+              |        |                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+         +--------------------------COMP:N-N(of)-------------------------+              |              |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |         |                                +---------MOD_ATT:N-ADJ--------+              |              |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+              |              |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A78">Analyse 78

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                                                               +--------------------------------COMP:V-N(with)--------------------------------+              |        |                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+         +--------------------------COMP:N-N(of)-------------------------+              |              |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |         |                                +---------MOD_ATT:N-ADJ--------+              |              |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+              |              |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A79">Analyse 79

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+                           +-----------------------COMP:N-N(with)-----------------------+              |        |                          
                             |                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                 +-----------------COMP:N-N(of)----------------+              |              |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |              |              |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
COMP:N-N(with) (__NODE__,box)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A80">Analyse 80

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+         +--------------------------------COMP:V-N(with)--------------------------------+              |        |                          
                             |                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                 +-----------------COMP:N-N(of)----------------+              |              |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |              |              |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A81">Analyse 81

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                                                               |                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,G?V)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A82">Analyse 82

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+                                                                                                       |        |                          
                             |                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                 +-----------------COMP:N-N(of)----------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A83">Analyse 83

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+                                                               |                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,G?V)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A84">Analyse 84

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+         +--------------------------------COMP:V-N(with)--------------------------------+              |        |                          
                             |                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+--------------------------COMP:N-N(of)-------------------------+              |              |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |              |              |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A85">Analyse 85

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+         +--------------------------------COMP:V-N(with)--------------------------------+              |        |                          
                             |                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+--------------------------COMP:N-N(of)-------------------------+              |              |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |              |              |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A86">Analyse 86

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+                                                                                                       |        |                          
                             |                                                    +--------OBJ:V-N--------+----------------SUBJ:V-N---------------+--------------------------COMP:N-N(of)-------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A87">Analyse 87

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+-----------------------COMP:N-N(of)----------------------+                                             |                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A88">Analyse 88

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+-------------------------------COMP:N-N(of)------------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+-----------------------COMP:N-N(of)----------------------+                                             |                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A89">Analyse 89

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                                      |                          
                                                                                  +----------------------------OBJ:V-N----------------------------+--------------------------COMP:N-N(of)-------------------------+                                      |                          
                                                                                  |                       +-----------------------COMP:N-N(of)----------------------+                                             |                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+                 |              +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A90">Analyse 90

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+                                                                                                       |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |                           +-----------------COMP:N-N(of)----------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A91">Analyse 91

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+                                                                                                       |        |                          
                             |                                                    +--------OBJ:V-N--------+                             +-------------------------------COMP:N-N(of)------------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,G?V)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A92">Analyse 92

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +------------------------------------------------------------OBJ:V-N------------------------------------------------------------+                             |        |                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+                                                                         |                             |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |                                                                         |                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
OBJ:V-N (contain,G?V)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A93">Analyse 93

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+                                                                                                       |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |         +--------------------------COMP:N-N(of)-------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A94">Analyse 94

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+                                                                                                       |        |                          
                             |                                                    +--------OBJ:V-N--------+                             +-------------------------------COMP:N-N(of)------------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+--------COMP:N-N(of)-------+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+                    +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |                    |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__NODE__)
COMP:N-N(of) (complex,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A95">Analyse 95

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +----------------------------OBJ:V-N----------------------------+--------------------------COMP:N-N(of)-------------------------+                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+                                +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A96">Analyse 96

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+                           +-----------------------COMP:N-N(with)-----------------------+              |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |                           +-----------------COMP:N-N(of)----------------+              |              |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |              |              |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
COMP:N-N(with) (__NODE__,box)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A97">Analyse 97

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+         +--------------------------------COMP:V-N(with)--------------------------------+              |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |         |                 +-----------------COMP:N-N(of)----------------+              |              |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |              |              |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
COMP:N-N(of) (__NODE__,G?V)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A98">Analyse 98

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +-----------------------OBJ:V-N-----------------------+         +--------------------------------COMP:V-N(with)--------------------------------+              |        |                          
                             |                                                    +--------OBJ:V-N--------+                             |         +--------------------------COMP:N-N(of)-------------------------+              |              |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             +--MOD_ATT:N-N--+         +---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |              |              |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,complex)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
COMP:V-N(with) (consist,box)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A99">Analyse 99

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                                      |                          
                                                                                  +----------------------------OBJ:V-N----------------------------+                                                               |                                      |                          
                                                                                  |                       +-----------------------COMP:N-N(of)----------------------+                                             |                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A100">Analyse 100

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                                      |                          
                                                                                  +----------------------------OBJ:V-N----------------------------+--------------------------COMP:N-N(of)-------------------------+                                      |                          
                                                                                  |                       +-----------------------COMP:N-N(of)----------------------+                                             |                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+                 |              +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+                  +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |                  |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A101">Analyse 101

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                                      |                          
                                                                                  +----------------------------OBJ:V-N----------------------------+--------------------------COMP:N-N(of)-------------------------+                                      |                          
                                                                                  |                       +-----------------------COMP:N-N(of)----------------------+                                             |                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+                 |              +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+                  +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |                  |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A102">Analyse 102

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +----------------------------OBJ:V-N----------------------------+                                                                                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A103">Analyse 103

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +----------------------------OBJ:V-N----------------------------+--------------------------COMP:N-N(of)-------------------------+                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+                                +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+                  +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |                  |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A104">Analyse 104

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+--------------------------COMP:N-N(of)-------------------------+                             |        |                          
                             |                                                    |                       +-----------------------COMP:N-N(of)----------------------+                                             |                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+                 |              +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A105">Analyse 105

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                                      |                          
                                                                                  +----------------------------OBJ:V-N----------------------------+                                                               |                                      |                          
                                                                                  |                       +-----------------------COMP:N-N(of)----------------------+                                             |                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+                  +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |                  |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A106">Analyse 106

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+--------------------------COMP:N-N(of)-------------------------+                             |        |                          
                             |                                                    |                       +-----------------------COMP:N-N(of)----------------------+                                             |                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+                 |              +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A107">Analyse 107

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                                      |                          
                                                                                  +----------------------------OBJ:V-N----------------------------+--------------------------COMP:N-N(of)-------------------------+                                      |                          
                                                                                  |                       +-----------------------COMP:N-N(of)----------------------+                                             |                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+                 |              +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A108">Analyse 108

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                                      |                          
                                                                                  +----------------------------OBJ:V-N----------------------------+--------------------------COMP:N-N(of)-------------------------+                                      |                          
                                                                                  |                       +-----------------------COMP:N-N(of)----------------------+                                             |                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+                 |              +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A109">Analyse 109

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+--------------------------COMP:N-N(of)-------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+                                +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A110">Analyse 110

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+--------------------------COMP:N-N(of)-------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+                                +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A111">Analyse 111

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +----------------------------OBJ:V-N----------------------------+--------------------------COMP:N-N(of)-------------------------+                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+                                +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A112">Analyse 112

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+                                                               |                             |        |                          
                             |                                                    |                       +-----------------------COMP:N-N(of)----------------------+                                             |                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A113">Analyse 113

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                                      |                          
                                                                                  +----------------------------OBJ:V-N----------------------------+                                                               |                                      |                          
                                                                                  |                       +-----------------------COMP:N-N(of)----------------------+                                             |                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A114">Analyse 114

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                                      |                          
                                                                                  +----------------------------OBJ:V-N----------------------------+                                                               |                                      |                          
                                                                                  |                       +-----------------------COMP:N-N(of)----------------------+                                             |                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A115">Analyse 115

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+--------------------------COMP:N-N(of)-------------------------+                             |        |                          
                             |                                                    |                       +-----------------------COMP:N-N(of)----------------------+                                             |                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+                 |              +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A116">Analyse 116

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                                      |                          
                                                                                  +----------------------------OBJ:V-N----------------------------+--------------------------COMP:N-N(of)-------------------------+                                      |                          
                                                                                  |                       +-----------------------COMP:N-N(of)----------------------+                                             |                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+                 |              +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+                  +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |                  |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A117">Analyse 117

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+                                                                                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A118">Analyse 118

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+                                                                                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A119">Analyse 119

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +----------------------------OBJ:V-N----------------------------+                                                                                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+            +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |            |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A120">Analyse 120

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+--------------------------COMP:N-N(of)-------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+                                +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A121">Analyse 121

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+--------------------------COMP:N-N(of)-------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+                                +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A122">Analyse 122

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +----------------------------OBJ:V-N----------------------------+--------------------------COMP:N-N(of)-------------------------+                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+                                +---------MOD_ATT:N-ADJ--------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+                  +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |                  |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A123">Analyse 123

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+                                                               |                             |        |                          
                             |                                                    |                       +-----------------------COMP:N-N(of)----------------------+                                             |                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A124">Analyse 124

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+                                                               |                             |        |                          
                             |                                                    |                       +-----------------------COMP:N-N(of)----------------------+                                             |                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A125">Analyse 125

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                                      |                          
                                                                                  +----------------------------OBJ:V-N----------------------------+                                                               |                                      |                          
                                                                                  |                       +-----------------------COMP:N-N(of)----------------------+                                             |                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+                  +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |                  |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A126">Analyse 126

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+--------------------------COMP:N-N(of)-------------------------+                             |        |                          
                             |                                                    |                       +-----------------------COMP:N-N(of)----------------------+                                             |                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+                 |              +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A127">Analyse 127

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+                                                                                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A128">Analyse 128

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+                                                                                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A129">Analyse 129

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+                                                                                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A130">Analyse 130

                                                                                  +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                                                                                  +----------------------------OBJ:V-N----------------------------+                                                                                                      |                          
    +---------OBJ:V-N--------+                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                                      +-----COMP:V-N(in)----+    
    |            +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                                      |          +MOD_ATT:N-+    
    |            |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+                  +-NEG+          |    +MOD_A+    
    |            |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |                  |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
OBJ:V-N (bind,fragment)
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A131">Analyse 131

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+--------------------------COMP:N-N(of)-------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+                                +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A132">Analyse 132

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+--------------------------COMP:N-N(of)-------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+                                +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A133">Analyse 133

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+                                                               |                             |        |                          
                             |                                                    |                       +-----------------------COMP:N-N(of)----------------------+                                             |                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A134">Analyse 134

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+                                                               |                             |        |                          
                             |                                                    |                       +-----------------------COMP:N-N(of)----------------------+                                             |                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A135">Analyse 135

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+--------------------------COMP:N-N(of)-------------------------+                             |        |                          
                             |                                                    |                       +-----------------------COMP:N-N(of)----------------------+                                             |                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+                 |              +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A136">Analyse 136

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+                                                                                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A137">Analyse 137

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+                                                                                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+SUBJ:+        |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |     |        |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
SUBJ:V_PASS-N (mutate,box)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A138">Analyse 138

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+--------------------------COMP:N-N(of)-------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+                                +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A139">Analyse 139

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+--------------------------COMP:N-N(of)-------------------------+                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+                                +---------MOD_ATT:N-ADJ--------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              |      +-----MOD_ATT:N-ADJ-----+                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      |       +-MOD_ATT:N-ADJ-+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (G?V,mutant)
MOD_ATT:N-ADJ (G?V,__SP__)
MOD_ATT:N-ADJ (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A140">Analyse 140

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+                                                               |                             |        |                          
                             |                                                    |                       +-----------------------COMP:N-N(of)----------------------+                                             |                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A141">Analyse 141

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    |                       +----------------------------------------------COMP:N-N(of)---------------------------------------------+                             |        |                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+                                                               |                             |        |                          
                             |                                                    |                       +-----------------------COMP:N-N(of)----------------------+                                             |                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
COMP:N-N(of) (element,__NODE__)
COMP:N-N(of) (element,G?V)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A142">Analyse 142

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+                                                                                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)

name="reponse" value="A143">Analyse 143

                             +---------------------------------------------------------------------------------------------------COMP:V-N(of)---------------------------------------------------------------------------------------------------+                                   
                             |                                                    +-------------------------------------------------------------------------------SUBJ:V-N-------------------------------------------------------------------------------+                          
                             |                                                    +----------------------------OBJ:V-N----------------------------+                                                                                             |        |                          
                             |                                                    +--------OBJ:V-N--------+             +-------MOD_ATT:N-N-------+--------------------------COMP:N-N(of)-------------------------+                             |        +-----COMP:V-N(in)----+    
                 +MOD_ATT:N-A+-------------------APPOS------------------+         |        +--MOD_ATT:N-N-+             |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+              +-MOD_ATT:N-ADJ+               |                             |        |          +MOD_ATT:N-+    
                 |    +MOD_AT+-------APPOS------+                       |         |        |      +MOD_ATT+             |       |       +MOD_ATT:N+          +MOD_AT+              |      +MOD_ATT+--MOD_ATT:N-N--+           +MO+              |   +-NEG+          |    +MOD_A+    
                 |    |      |                  |                       |         |        |      |       |             |       |       |         |          |      |              |      |       |               |           |  |              |   |    |          |    |     |    
 Binding of a mutant DNA fragment ( CATTCTAGGTCAAAGGTCATCCCCT ) ( G9A T10A ) containing a DR1 response element and a protein protein complex consisting of frog __NODE__ and of mutant __SP__ __NODE__ ( E?G G?S G?V with its P box mutated ) does not occur in a cell free system .
MOD_ATT:N-ADJ (fragment,mutant)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CATTCTAGGTCAAAGGTCATCCCCT)
APPOS (fragment,T10A)
OBJ:V-N (contain,element)
OBJ:V-N (contain,consist)
MOD_ATT:N-N (element,DR1)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,G?V)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,mutant)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (G?V,__NODE__)
MOD_ATT:N-N (box,P)
COMP:V-N(of) (do,fragment)
SUBJ:V-N (occur,contain)
NEG (occur,not)
COMP:V-N(in) (occur,system)
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)