In a cell free system , the affinity of binding of inverted repeat 6 response element ( 5 ' TATGAACTCAAAGGAGGTCAGT 3 ' from __SP__ __NODE__ gene and a dimeric protein protein complex consisting of __NODE__ and of __NODE__ is the same as the affinity of binding of inverted repeat 6 response element ( 5 ' TATGAACTCAAAGGAGGTCAGT 3 ' from __SP__ __NODE__ gene and a dimeric protein protein complex consisting of __NODE__ and of __NODE__ .