Validation pour Ingenuity189

vers la météo de la validation par utilisateur

Ingenuity189

precedent - 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 - suivant

Phrase 25 - PMID ?

In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a NODE NODE response element and NODE protein and NODE protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a NODE NODE response element and dimeric NODE protein .

name="reponse" value="NA"> Non annotée
name="reponse" value="JSP"> Je ne sais pas
name="reponse" value="INS"> Je n'ai pas trouvé d'analyse satisfaisante

Commentaires :

<?php echo $Com ; ?>

name="reponse" value="A0">Analyse 0

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
                                                                                                                     |           +------MOD_ATT:N-ADJ------+                    |            |                                                                                                           |           +------MOD_ATT:N-ADJ------+                            |     
                                                         +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                      +--------COMP:N-N(of)--------+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         +-SUBJ:V-N-+-OBJ:V-N-+-----APPOS-----+          |          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+COMP:N-V(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
SUBJ:V-N (purify,system)
OBJ:V-N (purify,component)
APPOS (component,affinity)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-V(of) (affinity,bind)
COMP:N-N(of) (affinity,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A1">Analyse 1

                                                                                                                     +--------------------------OBJ:V-N-------------------------+                                                                                                                        +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |                                                                                                                        +---------------OBJ:V-N---------------+                            |     
                                                                                                                     |           +------MOD_ATT:N-ADJ------+                    |                                                                                                                        |           +------MOD_ATT:N-ADJ------+                            |     
                                              +--------COMP:N-N(of)--------+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+           +--------------COMP:N-N(of)-------------+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         +-SUBJ:V-N-+-OBJ:V-N-+-----APPOS-----+COMP:N-V(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+COMP:N-V(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
SUBJ:V-N (purify,system)
OBJ:V-N (purify,component)
APPOS (component,affinity)
COMP:N-V(of) (affinity,bind)
COMP:N-N(of) (affinity,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (than,fragment)
COMP:N-V(of) (affinity,bind)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A2">Analyse 2

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
                                                                                                                     |           +------MOD_ATT:N-ADJ------+                    |            |                                                                                                           |           +------MOD_ATT:N-ADJ------+                            |     
                                              +--------COMP:N-N(of)--------+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         +-SUBJ:V-N-+-OBJ:V-N-+-----APPOS-----+COMP:N-V(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
SUBJ:V-N (purify,system)
OBJ:V-N (purify,component)
APPOS (component,affinity)
COMP:N-V(of) (affinity,bind)
COMP:N-N(of) (affinity,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A3">Analyse 3

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
                                                                                                                     |           +------MOD_ATT:N-ADJ------+                    |            |                                               +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                            |     
                                                         +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         +-SUBJ:V-N-+-OBJ:V-N-+-----APPOS-----+          |          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+          |          +MOD_AT+                   |                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
SUBJ:V-N (purify,system)
OBJ:V-N (purify,component)
APPOS (component,affinity)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A4">Analyse 4

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
                                                         +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                    +----------OBJ:V-N---------+                                                                                             |           +------MOD_ATT:N-ADJ------+                            |     
                                                         +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+           +--------------COMP:N-N(of)-------------+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         +-SUBJ:V-N-+-OBJ:V-N-+-----APPOS-----+          |          +MOD_AT+                   |                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+COMP:N-V(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
SUBJ:V-N (purify,system)
OBJ:V-N (purify,component)
APPOS (component,affinity)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,protein)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (than,fragment)
COMP:N-V(of) (affinity,bind)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A5">Analyse 5

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
                                                                                                                     |           +------MOD_ATT:N-ADJ------+                    |            |                                                                                                           |           +------MOD_ATT:N-ADJ------+                            |     
                                                         +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                      +--------COMP:N-N(of)--------+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         +-SUBJ:V-N-+-OBJ:V-N-+-----APPOS-----+COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+COMP:N-V(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
SUBJ:V-N (purify,system)
OBJ:V-N (purify,component)
APPOS (component,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-V(of) (affinity,bind)
COMP:N-N(of) (affinity,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A6">Analyse 6

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
                                                                                                                     |           +------MOD_ATT:N-ADJ------+                    |            |                                               +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                            |     
                                              +--------COMP:N-N(of)--------+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         +-SUBJ:V-N-+-OBJ:V-N-+-----APPOS-----+COMP:N-V(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+COMP:N-N(o+          +MOD_AT+                   |                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
SUBJ:V-N (purify,system)
OBJ:V-N (purify,component)
APPOS (component,affinity)
COMP:N-V(of) (affinity,bind)
COMP:N-N(of) (affinity,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A7">Analyse 7

                                                                                                                     +--------------------------OBJ:V-N-------------------------+                                                                                                                        +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |                                                                                                                        +---------------OBJ:V-N---------------+                            |     
                                                                                                                     |           +------MOD_ATT:N-ADJ------+                    |                                                                                                                        |           +------MOD_ATT:N-ADJ------+                            |     
                                                         +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+           +--------------COMP:N-N(of)-------------+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         +-SUBJ:V-N-+-OBJ:V-N-+-----APPOS-----+          |          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+COMP:N-V(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
SUBJ:V-N (purify,system)
OBJ:V-N (purify,component)
APPOS (component,affinity)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (than,fragment)
COMP:N-V(of) (affinity,bind)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A8">Analyse 8

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
                                                                                                                     |           +------MOD_ATT:N-ADJ------+                    |            |                                                                                                           |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+               +--------COMP:N-N(of)--------+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+-----APPOS-----+COMP:N-V(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+          |          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)
APPOS (component,affinity)
COMP:N-V(of) (affinity,bind)
COMP:N-N(of) (affinity,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A9">Analyse 9

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
         +----------------APPOS---------------+                                                                      |           +------MOD_ATT:N-ADJ------+                    |            |                                                                                                           |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+               +--------COMP:N-N(of)--------+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+               +COMP:N-V(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+          |          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
APPOS (system,affinity)
MOD_ATT:N-ADJ (component,purify)
COMP:N-V(of) (affinity,bind)
COMP:N-N(of) (affinity,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A10">Analyse 10

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
                                                                                                                     |           +------MOD_ATT:N-ADJ------+                    +----------OBJ:V-N---------+                                                                                             |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+               +--------COMP:N-N(of)--------+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                      +--------COMP:N-N(of)--------+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+-----APPOS-----+COMP:N-V(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+COMP:N-V(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)
APPOS (component,affinity)
COMP:N-V(of) (affinity,bind)
COMP:N-N(of) (affinity,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,protein)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-V(of) (affinity,bind)
COMP:N-N(of) (affinity,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A11">Analyse 11

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
         +----------------APPOS---------------+                                                                      |           +------MOD_ATT:N-ADJ------+                    |            |                                                                                                           |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+               +--------COMP:N-N(of)--------+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+               +COMP:N-V(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+          |          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
APPOS (system,affinity)
MOD_ATT:N-ADJ (component,purify)
COMP:N-V(of) (affinity,bind)
COMP:N-N(of) (affinity,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A12">Analyse 12

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
         +----------------APPOS---------------+                                                                      |           +------MOD_ATT:N-ADJ------+                    |            |                                                                                                           |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+               |          +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+           +--------------COMP:N-N(of)-------------+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+               |          |          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+COMP:N-V(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
APPOS (system,affinity)
MOD_ATT:N-ADJ (component,purify)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (than,fragment)
COMP:N-V(of) (affinity,bind)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A13">Analyse 13

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
         +----------------APPOS---------------+                                                                      |           +------MOD_ATT:N-ADJ------+                    |            |                                                                                                           |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+               |          +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+           +--------------COMP:N-N(of)-------------+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+               |          |          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+COMP:N-V(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
APPOS (system,affinity)
MOD_ATT:N-ADJ (component,purify)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (than,fragment)
COMP:N-V(of) (affinity,bind)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A14">Analyse 14

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
         +----------------APPOS---------------+          +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                    |            |                                                                                                           |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+               |          +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                      +--------COMP:N-N(of)--------+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+               |          |          +MOD_AT+                   |                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+COMP:N-V(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
APPOS (system,affinity)
MOD_ATT:N-ADJ (component,purify)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-V(of) (affinity,bind)
COMP:N-N(of) (affinity,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A15">Analyse 15

                                                                                                                     +--------------------------OBJ:V-N-------------------------+                                                                                                                        +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |                                                                                                                        +---------------OBJ:V-N---------------+                            |     
                                                                                                                     |           +------MOD_ATT:N-ADJ------+                    |                                                                                                                        |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+               +--------COMP:N-N(of)--------+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                      +--------COMP:N-N(of)--------+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+-----APPOS-----+COMP:N-V(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+COMP:N-V(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)
APPOS (component,affinity)
COMP:N-V(of) (affinity,bind)
COMP:N-N(of) (affinity,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-V(of) (affinity,bind)
COMP:N-N(of) (affinity,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A16">Analyse 16

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
                                                                                                                     |           +------MOD_ATT:N-ADJ------+                    |            |                                                                                                           |           +------MOD_ATT:N-ADJ------+                            |     
                                                         +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+           +--------------COMP:N-N(of)-------------+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         +-SUBJ:V-N-+-OBJ:V-N-+-----APPOS-----+          |          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
SUBJ:V-N (purify,system)
OBJ:V-N (purify,component)
APPOS (component,affinity)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (than,fragment)
COMP:N-N(of) (affinity,bind)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A17">Analyse 17

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
                                                         +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                    +----------OBJ:V-N---------+                                 +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                            |     
                                                         +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         +-SUBJ:V-N-+-OBJ:V-N-+-----APPOS-----+          |          +MOD_AT+                   |                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+          |          +MOD_AT+                   |                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
SUBJ:V-N (purify,system)
OBJ:V-N (purify,component)
APPOS (component,affinity)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,protein)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A18">Analyse 18

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
                                                                                                                     |           +------MOD_ATT:N-ADJ------+                    |            |                                                                                                           |           +------MOD_ATT:N-ADJ------+                            |     
                                                         +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         +-SUBJ:V-N-+-OBJ:V-N-+-----APPOS-----+COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+          |          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
SUBJ:V-N (purify,system)
OBJ:V-N (purify,component)
APPOS (component,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A19">Analyse 19

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
                                                                                                                     |           +------MOD_ATT:N-ADJ------+                    |            |                                                                                                           |           +------MOD_ATT:N-ADJ------+                            |     
                                              +--------COMP:N-N(of)--------+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         +-SUBJ:V-N-+-OBJ:V-N-+-----APPOS-----+COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+          |          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
SUBJ:V-N (purify,system)
OBJ:V-N (purify,component)
APPOS (component,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (affinity,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A20">Analyse 20

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
                                                                                                                     |           +------MOD_ATT:N-ADJ------+                    |            |                                               +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                            |     
                                                         +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         +-SUBJ:V-N-+-OBJ:V-N-+-----APPOS-----+COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+          |          +MOD_AT+                   |                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
SUBJ:V-N (purify,system)
OBJ:V-N (purify,component)
APPOS (component,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A21">Analyse 21

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
                                                                                                                     |           +------MOD_ATT:N-ADJ------+                    |            |                                               +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                            |     
                                                         +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         +-SUBJ:V-N-+-OBJ:V-N-+-----APPOS-----+          |          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+COMP:N-N(o+          +MOD_AT+                   |                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
SUBJ:V-N (purify,system)
OBJ:V-N (purify,component)
APPOS (component,affinity)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A22">Analyse 22

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
                                                                                                                     |           +------MOD_ATT:N-ADJ------+                    |            |                                               +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                            |     
                                              +--------COMP:N-N(of)--------+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         +-SUBJ:V-N-+-OBJ:V-N-+-----APPOS-----+COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+          |          +MOD_AT+                   |                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
SUBJ:V-N (purify,system)
OBJ:V-N (purify,component)
APPOS (component,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (affinity,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A23">Analyse 23

                                                                                                                     +--------------------------OBJ:V-N-------------------------+                                                                                                                        +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |                                                                                                                        +---------------OBJ:V-N---------------+                            |     
                                                                                                                     |           +------MOD_ATT:N-ADJ------+                    |                                                                                                                        |           +------MOD_ATT:N-ADJ------+                            |     
                                              +--------COMP:N-N(of)--------+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+           +--------------COMP:N-N(of)-------------+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         +-SUBJ:V-N-+-OBJ:V-N-+-----APPOS-----+COMP:N-V(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
SUBJ:V-N (purify,system)
OBJ:V-N (purify,component)
APPOS (component,affinity)
COMP:N-V(of) (affinity,bind)
COMP:N-N(of) (affinity,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (than,fragment)
COMP:N-N(of) (affinity,bind)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A24">Analyse 24

                                                                                                                     +--------------------------OBJ:V-N-------------------------+                                                                                                                        +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |                                                                                                                        +---------------OBJ:V-N---------------+                            |     
                                                                                                                     |           +------MOD_ATT:N-ADJ------+                    |                                                            +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                            |     
                                              +--------COMP:N-N(of)--------+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         +-SUBJ:V-N-+-OBJ:V-N-+-----APPOS-----+COMP:N-V(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+COMP:N-N(o+          +MOD_AT+                   |                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
SUBJ:V-N (purify,system)
OBJ:V-N (purify,component)
APPOS (component,affinity)
COMP:N-V(of) (affinity,bind)
COMP:N-N(of) (affinity,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A25">Analyse 25

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
                                                                                                                     |           +------MOD_ATT:N-ADJ------+                    |            |                                                                                                           |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+                          +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+-----APPOS-----+          |          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+          |          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)
APPOS (component,affinity)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A26">Analyse 26

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
                                                                                                                     |           +------MOD_ATT:N-ADJ------+                    |            |                                                                                                           |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+                          +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+-----APPOS-----+          |          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+          |          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)
APPOS (component,affinity)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A27">Analyse 27

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
                                                                                                                     |           +------MOD_ATT:N-ADJ------+                    |            |                                                                                                           |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+                          +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                      +--------COMP:N-N(of)--------+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+-----APPOS-----+COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+COMP:N-V(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)
APPOS (component,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-V(of) (affinity,bind)
COMP:N-N(of) (affinity,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A28">Analyse 28

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
                                                                                                                     |           +------MOD_ATT:N-ADJ------+                    |            |                                                                                                           |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+                          +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                      +--------COMP:N-N(of)--------+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+-----APPOS-----+COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+COMP:N-V(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)
APPOS (component,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-V(of) (affinity,bind)
COMP:N-N(of) (affinity,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A29">Analyse 29

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
                                                                                                                     |           +------MOD_ATT:N-ADJ------+                    |            |                                                                                                           |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+               +--------COMP:N-N(of)--------+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+           +--------------COMP:N-N(of)-------------+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+-----APPOS-----+COMP:N-V(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)
APPOS (component,affinity)
COMP:N-V(of) (affinity,bind)
COMP:N-N(of) (affinity,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (than,fragment)
COMP:N-N(of) (affinity,bind)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A30">Analyse 30

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
         +----------------APPOS---------------+                                                                      |           +------MOD_ATT:N-ADJ------+                    |            |                                                                                                           |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+               +--------COMP:N-N(of)--------+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+           +-----COMP:N-N(of)----+---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+               +COMP:N-V(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+          |          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
APPOS (system,affinity)
MOD_ATT:N-ADJ (component,purify)
COMP:N-V(of) (affinity,bind)
COMP:N-N(of) (affinity,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (than,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A31">Analyse 31

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
                                                         +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                    |            |                                               +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+                          +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+-----APPOS-----+          |          +MOD_AT+                   |                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+          |          +MOD_AT+                   |                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)
APPOS (component,affinity)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A32">Analyse 32

                                                                                                                     +--------------------------OBJ:V-N-------------------------+                                                                                                                        +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |                                                                                                                        +---------------OBJ:V-N---------------+                            |     
                                                                                                                     |           +------MOD_ATT:N-ADJ------+                    |                                                                                                                        |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+                          +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                      +--------COMP:N-N(of)--------+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+-----APPOS-----+          |          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+COMP:N-V(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)
APPOS (component,affinity)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-V(of) (affinity,bind)
COMP:N-N(of) (affinity,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A33">Analyse 33

                                                                                                                     +--------------------------OBJ:V-N-------------------------+                                                                                                                        +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |                                                                                                                        +---------------OBJ:V-N---------------+                            |     
         +----------------APPOS---------------+                                                                      |           +------MOD_ATT:N-ADJ------+                    |                                                                                                                        |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+               +--------COMP:N-N(of)--------+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+               +COMP:N-V(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+          |          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
APPOS (system,affinity)
MOD_ATT:N-ADJ (component,purify)
COMP:N-V(of) (affinity,bind)
COMP:N-N(of) (affinity,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A34">Analyse 34

                                                                                                                     +--------------------------OBJ:V-N-------------------------+                                                                                                                        +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |                                                                                                                        +---------------OBJ:V-N---------------+                            |     
         +----------------APPOS---------------+                                                                      |           +------MOD_ATT:N-ADJ------+                    |                                                            +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+               +--------COMP:N-N(of)--------+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+               +COMP:N-V(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+          |          +MOD_AT+                   |                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
APPOS (system,affinity)
MOD_ATT:N-ADJ (component,purify)
COMP:N-V(of) (affinity,bind)
COMP:N-N(of) (affinity,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A35">Analyse 35

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
                                                                                                                     |           +------MOD_ATT:N-ADJ------+                    |            |                                                                                                           |           +------MOD_ATT:N-ADJ------+                            |     
                                              +--------COMP:N-N(of)--------+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+           +-----COMP:N-N(of)----+---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         +-SUBJ:V-N-+-OBJ:V-N-+-----APPOS-----+COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+          |          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
SUBJ:V-N (purify,system)
OBJ:V-N (purify,component)
APPOS (component,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (affinity,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (than,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A36">Analyse 36

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
                                                                                                                     |           +------MOD_ATT:N-ADJ------+                    |            |                                               +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                            |     
                                                         +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+           +-----COMP:N-N(of)----+---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         +-SUBJ:V-N-+-OBJ:V-N-+-----APPOS-----+COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+          |          +MOD_AT+                   |                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
SUBJ:V-N (purify,system)
OBJ:V-N (purify,component)
APPOS (component,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (than,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A37">Analyse 37

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
                                                         +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                    +----------OBJ:V-N---------+                                                                                             |           +------MOD_ATT:N-ADJ------+                            |     
                                                         +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         +-SUBJ:V-N-+-OBJ:V-N-+-----APPOS-----+COMP:N-N(o+          +MOD_AT+                   |                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+          |          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
SUBJ:V-N (purify,system)
OBJ:V-N (purify,component)
APPOS (component,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,protein)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A38">Analyse 38

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
                                                         +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                    |            |                                               +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                            |     
                                                         +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         +-SUBJ:V-N-+-OBJ:V-N-+-----APPOS-----+COMP:N-N(o+          +MOD_AT+                   |                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+COMP:N-N(o+          +MOD_AT+                   |                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
SUBJ:V-N (purify,system)
OBJ:V-N (purify,component)
APPOS (component,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A39">Analyse 39

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
                                                         +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                    +----------OBJ:V-N---------+                                                                                             |           +------MOD_ATT:N-ADJ------+                            |     
                                                         +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         +-SUBJ:V-N-+-OBJ:V-N-+-----APPOS-----+COMP:N-N(o+          +MOD_AT+                   |                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+          |          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
SUBJ:V-N (purify,system)
OBJ:V-N (purify,component)
APPOS (component,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,protein)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A40">Analyse 40

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
                                                                                                                     |           +------MOD_ATT:N-ADJ------+                    +----------OBJ:V-N---------+                                 +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                            |     
                                              +--------COMP:N-N(of)--------+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         +-SUBJ:V-N-+-OBJ:V-N-+-----APPOS-----+COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+          |          +MOD_AT+                   |                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
SUBJ:V-N (purify,system)
OBJ:V-N (purify,component)
APPOS (component,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (affinity,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,protein)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A41">Analyse 41

                                                                                                                     +--------------------------OBJ:V-N-------------------------+                                                                                                                        +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |                                                                                                                        +---------------OBJ:V-N---------------+                            |     
                                                         +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                    |                                                                                                                        |           +------MOD_ATT:N-ADJ------+                            |     
                                                         +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         +-SUBJ:V-N-+-OBJ:V-N-+-----APPOS-----+          |          +MOD_AT+                   |                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
SUBJ:V-N (purify,system)
OBJ:V-N (purify,component)
APPOS (component,affinity)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A42">Analyse 42

                                                                                                                     +--------------------------OBJ:V-N-------------------------+                                                                                                                        +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |                                                                                                                        +---------------OBJ:V-N---------------+                            |     
                                                                                                                     |           +------MOD_ATT:N-ADJ------+                    |                                                            +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                            |     
                                                         +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         +-SUBJ:V-N-+-OBJ:V-N-+-----APPOS-----+COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+          |          +MOD_AT+                   |                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
SUBJ:V-N (purify,system)
OBJ:V-N (purify,component)
APPOS (component,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A43">Analyse 43

                                                                                                                     +--------------------------OBJ:V-N-------------------------+                                                                                                                        +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |                                                                                                                        +---------------OBJ:V-N---------------+                            |     
                                                         +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                    |                                                                                                                        |           +------MOD_ATT:N-ADJ------+                            |     
                                                         +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                      +--------COMP:N-N(of)--------+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         +-SUBJ:V-N-+-OBJ:V-N-+-----APPOS-----+          |          +MOD_AT+                   |                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
SUBJ:V-N (purify,system)
OBJ:V-N (purify,component)
APPOS (component,affinity)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (affinity,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A44">Analyse 44

                                                                                                                     +--------------------------OBJ:V-N-------------------------+                                                                                                                        +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |                                                                                                                        +---------------OBJ:V-N---------------+                            |     
                                                         +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                    |                                                                                                                        |           +------MOD_ATT:N-ADJ------+                            |     
                                                         +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         +-SUBJ:V-N-+-OBJ:V-N-+-----APPOS-----+COMP:N-N(o+          +MOD_AT+                   |                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+          |          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
SUBJ:V-N (purify,system)
OBJ:V-N (purify,component)
APPOS (component,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A45">Analyse 45

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
                                                                                                                     |           +------MOD_ATT:N-ADJ------+                    +----------OBJ:V-N---------+                                                                                             |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+                          +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+-----APPOS-----+          |          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+          |          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)
APPOS (component,affinity)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,protein)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A46">Analyse 46

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
         +----------------APPOS---------------+                                                                      |           +------MOD_ATT:N-ADJ------+                    |            |                                                                                                           |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+               |          +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+               +COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+          |          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
APPOS (system,affinity)
MOD_ATT:N-ADJ (component,purify)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A47">Analyse 47

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
                                                         +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                    |            |                                                                                                           |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+                          +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                      +--------COMP:N-N(of)--------+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+-----APPOS-----+          |          +MOD_AT+                   |                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)
APPOS (component,affinity)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (affinity,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A48">Analyse 48

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
                                                         +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                    |            |                                                                                                           |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+                          +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+           +-----COMP:N-N(of)----+---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+-----APPOS-----+          |          +MOD_AT+                   |                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+          |          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)
APPOS (component,affinity)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (than,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A49">Analyse 49

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
         +----------------APPOS---------------+                                                                      |           +------MOD_ATT:N-ADJ------+                    +----------OBJ:V-N---------+                                                                                             |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+               |          +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                      +--------COMP:N-N(of)--------+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+               +COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+COMP:N-V(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
APPOS (system,affinity)
MOD_ATT:N-ADJ (component,purify)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,protein)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-V(of) (affinity,bind)
COMP:N-N(of) (affinity,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A50">Analyse 50

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
         +----------------APPOS---------------+                                                                      |           +------MOD_ATT:N-ADJ------+                    +----------OBJ:V-N---------+                                                                                             |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+               +--------COMP:N-N(of)--------+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+               +COMP:N-V(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
APPOS (system,affinity)
MOD_ATT:N-ADJ (component,purify)
COMP:N-V(of) (affinity,bind)
COMP:N-N(of) (affinity,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,protein)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A51">Analyse 51

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
                                                                                                                     |           +------MOD_ATT:N-ADJ------+                    +----------OBJ:V-N---------+                                                                                             |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+               +--------COMP:N-N(of)--------+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+           +--------------COMP:N-N(of)-------------+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+-----APPOS-----+COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+COMP:N-V(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)
APPOS (component,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (affinity,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,protein)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (than,fragment)
COMP:N-V(of) (affinity,bind)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A52">Analyse 52

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
         +----------------APPOS---------------+          +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                    +----------OBJ:V-N---------+                                                                                             |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+               |          +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+               |          |          +MOD_AT+                   |                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+          |          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
APPOS (system,affinity)
MOD_ATT:N-ADJ (component,purify)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,protein)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A53">Analyse 53

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
                                                                                                                     |           +------MOD_ATT:N-ADJ------+                    +----------OBJ:V-N---------+                                 +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+               +--------COMP:N-N(of)--------+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+           +-----COMP:N-N(of)----+---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+-----APPOS-----+COMP:N-V(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+          |          +MOD_AT+                   |                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)
APPOS (component,affinity)
COMP:N-V(of) (affinity,bind)
COMP:N-N(of) (affinity,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,protein)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (than,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A54">Analyse 54

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
         +----------------APPOS---------------+          +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                    |            |                                               +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+               |          +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+               +COMP:N-N(o+          +MOD_AT+                   |                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+          |          +MOD_AT+                   |                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
APPOS (system,affinity)
MOD_ATT:N-ADJ (component,purify)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A55">Analyse 55

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
                                                                                                                     |           +------MOD_ATT:N-ADJ------+                    |            |                                                                                                           |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+                          +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+-----APPOS-----+COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+          |          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)
APPOS (component,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A56">Analyse 56

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
                                                         +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                    |            |                                                                                                           |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+                          +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+-----APPOS-----+COMP:N-N(o+          +MOD_AT+                   |                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+          |          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)
APPOS (component,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A57">Analyse 57

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
                                                         +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                    |            |                                                                                                           |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+                          +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+-----APPOS-----+COMP:N-N(o+          +MOD_AT+                   |                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+          |          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)
APPOS (component,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A58">Analyse 58

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
                                                                                                                     |           +------MOD_ATT:N-ADJ------+                    |            |                                               +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+               +--------COMP:N-N(of)--------+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+-----APPOS-----+COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+          |          +MOD_AT+                   |                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)
APPOS (component,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (affinity,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A59">Analyse 59

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
         +----------------APPOS---------------+          +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                    |            |                                                                                                           |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+               |          +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+               +COMP:N-N(o+          +MOD_AT+                   |                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+          |          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
APPOS (system,affinity)
MOD_ATT:N-ADJ (component,purify)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A60">Analyse 60

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
         +----------------APPOS---------------+                                                                      |           +------MOD_ATT:N-ADJ------+                    |            |                                                                                                           |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+               |          +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+           +--------------COMP:N-N(of)-------------+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+               |          |          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
APPOS (system,affinity)
MOD_ATT:N-ADJ (component,purify)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (than,fragment)
COMP:N-N(of) (affinity,bind)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A61">Analyse 61

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
                                                         +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                    |            |                                               +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+                          +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+-----APPOS-----+          |          +MOD_AT+                   |                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+COMP:N-N(o+          +MOD_AT+                   |                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)
APPOS (component,affinity)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A62">Analyse 62

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
         +----------------APPOS---------------+                                                                      |           +------MOD_ATT:N-ADJ------+                    |            |                                               +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+               +--------COMP:N-N(of)--------+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+               +COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+          |          +MOD_AT+                   |                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
APPOS (system,affinity)
MOD_ATT:N-ADJ (component,purify)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (affinity,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A63">Analyse 63

                                                                                                                     +--------------------------OBJ:V-N-------------------------+                                                                                                                        +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |                                                                                                                        +---------------OBJ:V-N---------------+                            |     
         +----------------APPOS---------------+          +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                    |                                                            +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+               |          +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+               |          |          +MOD_AT+                   |                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+          |          +MOD_AT+                   |                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
APPOS (system,affinity)
MOD_ATT:N-ADJ (component,purify)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A64">Analyse 64

                                                                                                                                                                                                                                                                                                         +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                                                                                                                                             +---------------OBJ:V-N---------------+                            |     
         +----------------APPOS---------------+          +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                                                                                                                                             |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+               |          +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+                                 +---OBJ:V-N---+           +--------------COMP:N-N(of)-------------+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+               |          |          +MOD_AT+                   |                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+COMP:N-V(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
APPOS (system,affinity)
MOD_ATT:N-ADJ (component,purify)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (than,fragment)
COMP:N-V(of) (affinity,bind)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A65">Analyse 65

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
                                                                                                                     |           +------MOD_ATT:N-ADJ------+                    +----------OBJ:V-N---------+                                                                                             |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+                          +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+-----APPOS-----+COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+          |          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)
APPOS (component,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,protein)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A66">Analyse 66

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
                                                                                                                     |           +------MOD_ATT:N-ADJ------+                    +----------OBJ:V-N---------+                                                                                             |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+                          +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                      +--------COMP:N-N(of)--------+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+-----APPOS-----+          |          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)
APPOS (component,affinity)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,protein)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (affinity,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A67">Analyse 67

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
                                                         +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                    +----------OBJ:V-N---------+                                                                                             |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+                          +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+-----APPOS-----+COMP:N-N(o+          +MOD_AT+                   |                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+          |          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)
APPOS (component,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,protein)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A68">Analyse 68

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
                                                                                                                     |           +------MOD_ATT:N-ADJ------+                    |            |                                                                                                           |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+               +--------COMP:N-N(of)--------+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+           +--------------COMP:N-N(of)-------------+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+-----APPOS-----+COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)
APPOS (component,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (affinity,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (than,fragment)
COMP:N-N(of) (affinity,bind)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A69">Analyse 69

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
         +----------------APPOS---------------+                                                                      |           +------MOD_ATT:N-ADJ------+                    |            |                                                                                                           |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+               +--------COMP:N-N(of)--------+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+           +-----COMP:N-N(of)----+---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+               +COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+          |          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
APPOS (system,affinity)
MOD_ATT:N-ADJ (component,purify)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (affinity,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (than,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A70">Analyse 70

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
                                                         +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                    |            |                                                                                                           |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+                          +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+           +--------------COMP:N-N(of)-------------+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+-----APPOS-----+COMP:N-N(o+          +MOD_AT+                   |                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)
APPOS (component,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (than,fragment)
COMP:N-N(of) (affinity,bind)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A71">Analyse 71

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
         +----------------APPOS---------------+          +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                    +----------OBJ:V-N---------+                                                                                             |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+               |          +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                      +--------COMP:N-N(of)--------+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+               |          |          +MOD_AT+                   |                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
APPOS (system,affinity)
MOD_ATT:N-ADJ (component,purify)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,protein)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (affinity,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A72">Analyse 72

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
         +----------------APPOS---------------+                                                                      |           +------MOD_ATT:N-ADJ------+                    |            |                                                                                                           |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+               |          +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+               +COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
APPOS (system,affinity)
MOD_ATT:N-ADJ (component,purify)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A73">Analyse 73

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
         +----------------APPOS---------------+                                                                      |           +------MOD_ATT:N-ADJ------+                    |            |                                                                                                           |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+               +--------COMP:N-N(of)--------+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+               +COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
APPOS (system,affinity)
MOD_ATT:N-ADJ (component,purify)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (affinity,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A74">Analyse 74

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
         +----------------APPOS---------------+          +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                    |            |                                               +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+               |          +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+               +COMP:N-N(o+          +MOD_AT+                   |                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+COMP:N-N(o+          +MOD_AT+                   |                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
APPOS (system,affinity)
MOD_ATT:N-ADJ (component,purify)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A75">Analyse 75

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
         +----------------APPOS---------------+          +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                    |            |                                               +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+               |          +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+           +-----COMP:N-N(of)----+---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+               +COMP:N-N(o+          +MOD_AT+                   |                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+          |          +MOD_AT+                   |                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
APPOS (system,affinity)
MOD_ATT:N-ADJ (component,purify)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (than,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A76">Analyse 76

                                                                                                                     +--------------------------OBJ:V-N-------------------------+                                                                                                                        +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |                                                                                                                        +---------------OBJ:V-N---------------+                            |     
         +----------------APPOS---------------+                                                                      |           +------MOD_ATT:N-ADJ------+                    |                                                                                                                        |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+               |          +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                      +--------COMP:N-N(of)--------+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+               |          |          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
APPOS (system,affinity)
MOD_ATT:N-ADJ (component,purify)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (affinity,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A77">Analyse 77

                                                                                                                     +--------------------------OBJ:V-N-------------------------+                                                                                                                        +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |                                                                                                                        +---------------OBJ:V-N---------------+                            |     
         +----------------APPOS---------------+          +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                    |                                                                                                                        |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+               |          +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                      +--------COMP:N-N(of)--------+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+               |          |          +MOD_AT+                   |                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
APPOS (system,affinity)
MOD_ATT:N-ADJ (component,purify)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (affinity,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A78">Analyse 78

                                                                                                                     +--------------------------OBJ:V-N-------------------------+                                                                                                                        +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |                                                                                                                        +---------------OBJ:V-N---------------+                            |     
                                                         +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                    |                                                            +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+                          +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+           +-----COMP:N-N(of)----+---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+-----APPOS-----+          |          +MOD_AT+                   |                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+          |          +MOD_AT+                   |                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)
APPOS (component,affinity)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (than,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A79">Analyse 79

                                                                                                                                                                                                                                                                                                         +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                                                                                                                                             +---------------OBJ:V-N---------------+                            |     
                                                                                                                     |           +------MOD_ATT:N-ADJ------+                                                                                 +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                            |     
                                              +--------COMP:N-N(of)--------+                                         |           |        +--MOD_ATT:N-ADJ-+                                 +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         +-SUBJ:V-N-+-OBJ:V-N-+-----APPOS-----+COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+          |          +MOD_AT+                   |                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
SUBJ:V-N (purify,system)
OBJ:V-N (purify,component)
APPOS (component,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (affinity,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A80">Analyse 80

                                                                                                                                                                                                                                                                                                         +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                                                                                                                                             +---------------OBJ:V-N---------------+                            |     
                                                                                                                     |           +------MOD_ATT:N-ADJ------+                                                                                 +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+               +--------COMP:N-N(of)--------+                                         |           |        +--MOD_ATT:N-ADJ-+                                 +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+-----APPOS-----+COMP:N-V(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+COMP:N-N(o+          +MOD_AT+                   |                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)
APPOS (component,affinity)
COMP:N-V(of) (affinity,bind)
COMP:N-N(of) (affinity,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A81">Analyse 81

                                                                                                                     +--------------------------------OBJ:V-N--------------------------------+                                                                                                                                                                                    
                                                                                                                     +--------------------------OBJ:V-N-------------------------+            |                                                                                                           +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |            |                                                                                                           +---------------OBJ:V-N---------------+                            |     
         +----------------APPOS---------------+                                                                      |           +------MOD_ATT:N-ADJ------+                    +----------OBJ:V-N---------+                                 +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+               |          +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+           +-----COMP:N-N(of)----+---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+               +COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+          |          +MOD_AT+                   |                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
APPOS (system,affinity)
MOD_ATT:N-ADJ (component,purify)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,protein)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (than,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A82">Analyse 82

                                                                                                                     +--------------------------OBJ:V-N-------------------------+                                                                                                                        +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |                                                                                                                        +---------------OBJ:V-N---------------+                            |     
         +----------------APPOS---------------+          +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                    |                                                                                                                        |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+               |          +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+               +COMP:N-N(o+          +MOD_AT+                   |                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
APPOS (system,affinity)
MOD_ATT:N-ADJ (component,purify)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A83">Analyse 83

                                                                                                                     +--------------------------OBJ:V-N-------------------------+                                                                                                                        +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                    |                                                                                                                        +---------------OBJ:V-N---------------+                            |     
                                                         +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                    |                                                            +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+                          +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+                    |            +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+-----APPOS-----+COMP:N-N(o+          +MOD_AT+                   |                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+COMP:N-N(o+          +MOD_AT+                   |                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)
APPOS (component,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A84">Analyse 84

                                                                                                                                                                                                                                                                                                         +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                                                                                                                                             +---------------OBJ:V-N---------------+                            |     
                                                         +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                                                                                 +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                            |     
                                                         +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+                                 +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         +-SUBJ:V-N-+-OBJ:V-N-+-----APPOS-----+COMP:N-N(o+          +MOD_AT+                   |                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+COMP:N-N(o+          +MOD_AT+                   |                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
SUBJ:V-N (purify,system)
OBJ:V-N (purify,component)
APPOS (component,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A85">Analyse 85

                                                                                                                                                                                                                                                                                                         +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                                                                                                                                             +---------------OBJ:V-N---------------+                            |     
                                                                                                                     |           +------MOD_ATT:N-ADJ------+                                                                                                                                             |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+                          +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+                                 +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+-----APPOS-----+COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+          |          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)
APPOS (component,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A86">Analyse 86

                                                                                                                                                                                                                                                                                                         +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                                                                                                                                             +---------------OBJ:V-N---------------+                            |     
         +----------------APPOS---------------+          +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                                                                                                                                             |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+               |          +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+                                 +---OBJ:V-N---+                                 +---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+               +COMP:N-N(o+          +MOD_AT+                   |                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+          |          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
APPOS (system,affinity)
MOD_ATT:N-ADJ (component,purify)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A87">Analyse 87

                                                                                                                                                                                                                                                                                                         +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                                                                                                                                             +---------------OBJ:V-N---------------+                            |     
                                                                                                                     |           +------MOD_ATT:N-ADJ------+                                                                                                                                             |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+               +--------COMP:N-N(of)--------+                                         |           |        +--MOD_ATT:N-ADJ-+                                 +---OBJ:V-N---+           +--------------COMP:N-N(of)-------------+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+-----APPOS-----+COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)
APPOS (component,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (affinity,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (than,fragment)
COMP:N-N(of) (affinity,bind)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A88">Analyse 88

                                                                                                                                                                                                                                                                                                         +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                                                                                                                                             +---------------OBJ:V-N---------------+                            |     
         +----------------APPOS---------------+                                                                      |           +------MOD_ATT:N-ADJ------+                                                                                                                                             |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+               +--------COMP:N-N(of)--------+                                         |           |        +--MOD_ATT:N-ADJ-+                                 +---OBJ:V-N---+           +-----COMP:N-N(of)----+---COMP:N-N(of)--+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+               +COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+          |          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
APPOS (system,affinity)
MOD_ATT:N-ADJ (component,purify)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (affinity,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (than,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)

name="reponse" value="A89">Analyse 89

                                                                                                                                                                                                                                                                                                         +------------------------------OBJ:V-N-----------------------------+     
                                                                                                                     +---------------OBJ:V-N---------------+                                                                                                                                             +---------------OBJ:V-N---------------+                            |     
                                                         +----------------APPOS----------------+                     |           +------MOD_ATT:N-ADJ------+                                                                                                                                             |           +------MOD_ATT:N-ADJ------+                            |     
         +----COMP:N-N(of)----+                          +---COMP:N-N(of)--+                   |                     |           |        +--MOD_ATT:N-ADJ-+                                 +---OBJ:V-N---+           +--------------COMP:N-N(of)-------------+                                         |           |        +--MOD_ATT:N-ADJ-+           +--MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+-----APPOS-----+COMP:N-N(o+          +MOD_AT+                   |                     |           |        |        +MOD_ATT+            +MOD_ATT+            |       +SUBJ:+           +--OBJ:V-N-+COMP:N-N(o+          +MOD_AT+-------APPOS-------+                     |           |        |        +MOD_ATT+           |        +MOD_ATT+     
         |          |         |               |          |          |      |                   |                     |           |        |        |       |            |       |            |       |     |           |          |          |          |      |                   |                     |           |        |        |       |           |        |       |     
 In a system of purified components , the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and __NODE__ protein and __NODE__ protein is greater than the affinity of binding of a DNA fragment ( TCGACTCTGACCTCTCGTTGACCTGCT ) containing a __NODE__ __NODE__ response element and dimeric __NODE__ protein .
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)
APPOS (component,affinity)
COMP:N-N(of) (affinity,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTCTGACCTCTCGTTGACCTGCT)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (than,affinity)
COMP:N-N(of) (than,fragment)
COMP:N-N(of) (affinity,bind)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTCTGACCTCTCGTTGACCTGCT)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,dimeric)
MOD_ATT:N-ADJ (protein,__NODE__)