Validation pour Ingenuity294

vers la météo de la validation par utilisateur

Ingenuity294

precedent - 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 - suivant

Phrase 45 - PMID ?

In proliferating endothelial cells , SP NODE protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a NODE binding site and SP NODE protein .

Non annotée
Je ne sais pas
Je n'ai pas trouvé d'analyse satisfaisante

Commentaires :

Analyse 0

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                +---------------COMP:V-N(In)---------------+                                                    +---------------OBJ:V-N--------------+       |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+         |       |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
OBJ:V-N (__NODE__,protein)

Analyse 1

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                +---------------COMP:V-N(In)---------------+                                                    +---------------OBJ:V-N--------------+       |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+         |       |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
OBJ:V-N (__NODE__,protein)

Analyse 2

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 3

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 4

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 5

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 6

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 7

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +-------------------------------------------------------MOD_ATT:N-ADJ-------------------------------------------------------+       |             
                                |        |       +---------------------------------------------------MOD_ATT:N-ADJ---------------------------------------------------+       |             
                                |        |       |                +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                    |       |             
                                +---------------COMP:V-N(In)---------------+                                                    |                                    |       |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+         |       |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__SP__,__SP__)
MOD_ATT:N-ADJ (__SP__,__NODE__)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 8

  +---------------------------------------------------------------------------------MOD:V-ADV--------------------------------------------------------------------------------+             
  |                             +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
  |                             |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
  |                             |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
  |                             |        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
  |                    +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
  |                    |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD:V-ADV (__NODE__,in)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 9

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                +---------------COMP:V-N(In)---------------+                                                    |                                            |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 10

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                +---------------COMP:V-N(In)---------------+                                                    |                                            |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 11

  +---------------------------------------------------------------------------------MOD:V-ADV--------------------------------------------------------------------------------+             
  |                             +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
  +----------------------------------------------------------MOD:V-ADV----------------------------------------------------------+                                            |             
  |                             |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
  +--------------------------------MOD:V-ADV-------------------------------+                                                    |                                            |             
  |                             |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
  |                             |        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
  |                    +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
  |                    |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
MOD:V-ADV (bind,in)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
MOD:V-ADV (contain,in)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD:V-ADV (__NODE__,in)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 12

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                +---------------COMP:V-N(In)---------------+                                                    |                                            |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 13

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 14

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 15

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 16

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 17

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 18

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 19

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 20

                                                                                                                                +-----------------------OBJ:V-N----------------------+     
                                +-----------COMP:V-N(In)----------+        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |     
          +----MOD_ATT:N-ADJ----+        +-MOD_ATT:N-ADJ-+        |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+     
          |            +MOD_ATT:+        |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:V-N(In) (increase,cell)
SUBJ:V-N (increase,protein)
OBJ:V-N (increase,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 21

                                                                                                                                +-----------------------OBJ:V-N----------------------+     
                                +-----------COMP:V-N(In)----------+        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |     
          +----MOD_ATT:N-ADJ----+        +-MOD_ATT:N-ADJ-+        |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+     
          |            +MOD_ATT:+        |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:V-N(In) (increase,cell)
SUBJ:V-N (increase,protein)
OBJ:V-N (increase,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 22

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+---------------OBJ:V-N--------------+       |             
                                +---------------COMP:V-N(In)---------------+                                                    +----------OBJ:V-N---------+         |       |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+           +------MOD_ATT:N-ADJ-----+       |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__SP__,__NODE__)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
OBJ:V-N (__NODE__,protein)

Analyse 23

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                +---------------COMP:V-N(In)---------------+                                                    +---------------OBJ:V-N--------------+       |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+         |       |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
OBJ:V-N (__NODE__,protein)

Analyse 24

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                +---------------COMP:V-N(In)---------------+                                                    +---------------OBJ:V-N--------------+       |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+         |       |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
OBJ:V-N (__NODE__,protein)

Analyse 25

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 26

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 27

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 28

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 29

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 30

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 31

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 32

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 33

                                                                  +------------------------------------------------------OBJ:V-N-----------------------------------------------------+     
                                +-----------COMP:V-N(In)----------+        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |     
          +----MOD_ATT:N-ADJ----+        +-MOD_ATT:N-ADJ-+        |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+     
          |            +MOD_ATT:+        |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:V-N(In) (increase,cell)
SUBJ:V-N (increase,protein)
OBJ:V-N (increase,bind)
OBJ:V-N (increase,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 34

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +-------------------------------------------------------MOD_ATT:N-ADJ-------------------------------------------------------+       |             
                                |        |       +---------------------------------------------------MOD_ATT:N-ADJ---------------------------------------------------+       |             
                                |        |       |                +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                    |       |             
                                +---------------COMP:V-N(In)---------------+                                                    |                                    |       |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+         |       |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__SP__,__SP__)
MOD_ATT:N-ADJ (__SP__,__NODE__)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 35

  +---------------------------------------------------------------------------------MOD:V-ADV--------------------------------------------------------------------------------+             
  |                             +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
  |                             |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
  |                             |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
  |                             |        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
  |                    +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
  |                    |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD:V-ADV (__NODE__,in)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 36

  +---------------------------------------------------------------------------------MOD:V-ADV--------------------------------------------------------------------------------+             
  |                             +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
  |                             |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
  |                             |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
  |                             |        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
  |                    +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
  |                    |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD:V-ADV (__NODE__,in)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 37

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                +---------------COMP:V-N(In)---------------+                                                    |                                            |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 38

  +---------------------------------------------------------------------------------MOD:V-ADV--------------------------------------------------------------------------------+             
  |                             +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
  +----------------------------------------------------------MOD:V-ADV----------------------------------------------------------+                                            |             
  |                             |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
  +--------------------------------MOD:V-ADV-------------------------------+                                                    |                                            |             
  |                             |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
  |                             |        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
  |                    +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
  |                    |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
MOD:V-ADV (bind,in)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
MOD:V-ADV (contain,in)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD:V-ADV (__NODE__,in)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 39

  +---------------------------------------------------------------------------------MOD:V-ADV--------------------------------------------------------------------------------+             
  |                             +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
  +----------------------------------------------------------MOD:V-ADV----------------------------------------------------------+                                            |             
  |                             |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
  +--------------------------------MOD:V-ADV-------------------------------+                                                    |                                            |             
  |                             |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
  |                             |        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
  |                    +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
  |                    |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
MOD:V-ADV (bind,in)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
MOD:V-ADV (contain,in)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD:V-ADV (__NODE__,in)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 40

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                +---------------COMP:V-N(In)---------------+                                                    |                                            |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 41

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 42

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 43

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 44

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 45

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 46

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 47

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 48

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 49

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 50

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------------------APPOS---------------------------+                                                              |             
                                |                +----------------COMP:N-N(of)---------------+                |                 +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,CGTATTAACCACAATACTCG)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 51

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------------------APPOS---------------------------+                                                              |             
                                |                +----------------COMP:N-N(of)---------------+                |                 +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,CGTATTAACCACAATACTCG)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 52

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------------------APPOS-------------------------------+                                                              |             
                                |        +--------------------COMP:N-N(of)-------------------+                |                 +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
APPOS (__SP__,CGTATTAACCACAATACTCG)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 53

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------------------APPOS-------------------------------+                                                              |             
                                |        +--------------------COMP:N-N(of)-------------------+                |                 +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
APPOS (__SP__,CGTATTAACCACAATACTCG)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 54

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 55

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 56

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 57

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------------------APPOS---------------------------+                                                              |             
                                |                +----------------COMP:N-N(of)---------------+                |                 +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,CGTATTAACCACAATACTCG)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 58

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------------------APPOS---------------------------+                                                              |             
                                |                +----------------COMP:N-N(of)---------------+                |                 +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,CGTATTAACCACAATACTCG)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 59

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------------------APPOS-------------------------------+                                                              |             
                                |        +--------------------COMP:N-N(of)-------------------+                |                 +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
APPOS (__SP__,CGTATTAACCACAATACTCG)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 60

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------------------APPOS-------------------------------+                                                              |             
                                |        +--------------------COMP:N-N(of)-------------------+                |                 +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
APPOS (__SP__,CGTATTAACCACAATACTCG)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 61

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 62

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 63

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 64

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 65

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------------------APPOS---------------------------+                                                              |             
                                |                +----------------COMP:N-N(of)---------------+                |                 +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,CGTATTAACCACAATACTCG)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 66

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------------------APPOS-------------------------------+                                                              |             
                                |        +--------------------COMP:N-N(of)-------------------+                |                 +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
APPOS (__SP__,CGTATTAACCACAATACTCG)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 67

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 68

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 69

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 70

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 71

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------------------APPOS---------------------------+                                                              |             
                                |                +----------------COMP:N-N(of)---------------+                |                 +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,CGTATTAACCACAATACTCG)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 72

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------------------APPOS---------------------------+                                                              |             
                                |                +----------------COMP:N-N(of)---------------+                |                 +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,CGTATTAACCACAATACTCG)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 73

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------------------APPOS-------------------------------+                                                              |             
                                |        +--------------------COMP:N-N(of)-------------------+                |                 +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
APPOS (__SP__,CGTATTAACCACAATACTCG)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 74

                                                                                                                                +-----------------------OBJ:V-N----------------------+     
                                +-----------COMP:V-N(In)----------+        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |     
          +----MOD_ATT:N-ADJ----+        +-MOD_ATT:N-ADJ-+        |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+     
          |            +MOD_ATT:+        |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:V-N(In) (increase,cell)
SUBJ:V-N (increase,protein)
OBJ:V-N (increase,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 75

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                |                                 |                                                             +---------------OBJ:V-N--------------+       |             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+----------OBJ:V-N---------+         |       |             
                                +---------------COMP:V-N(In)---------------+                                                    |           +------MOD_ATT:N-ADJ-----+       |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+           |       +--MOD_ATT:N-ADJ-+       |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__SP__,__NODE__)
MOD_ATT:N-ADJ (__SP__,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
OBJ:V-N (__NODE__,protein)

Analyse 76

                                                                                                                                +-----------------------OBJ:V-N----------------------+     
                                +-----------COMP:V-N(In)----------+        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |     
          +----MOD_ATT:N-ADJ----+        +-MOD_ATT:N-ADJ-+        |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+     
          |            +MOD_ATT:+        |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:V-N(In) (increase,cell)
SUBJ:V-N (increase,protein)
OBJ:V-N (increase,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 77

                                                                                                                                +-----------------------OBJ:V-N----------------------+     
                                +-----------COMP:V-N(In)----------+        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |     
          +----MOD_ATT:N-ADJ----+        +-MOD_ATT:N-ADJ-+        |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+     
          |            +MOD_ATT:+        |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:V-N(In) (increase,cell)
SUBJ:V-N (increase,protein)
OBJ:V-N (increase,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 78

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                +---------------COMP:V-N(In)---------------+                                                    +---------------OBJ:V-N--------------+       |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+         |       |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
OBJ:V-N (__NODE__,protein)

Analyse 79

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                +---------------COMP:V-N(In)---------------+                                                    +---------------OBJ:V-N--------------+       |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+         |       |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
OBJ:V-N (__NODE__,protein)

Analyse 80

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 81

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 82

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 83

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 84

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 85

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 86

                                                                  +------------------------------------------------------OBJ:V-N-----------------------------------------------------+     
                                +-----------COMP:V-N(In)----------+        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |     
          +----MOD_ATT:N-ADJ----+        +-MOD_ATT:N-ADJ-+        |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+     
          |            +MOD_ATT:+        |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:V-N(In) (increase,cell)
SUBJ:V-N (increase,protein)
OBJ:V-N (increase,bind)
OBJ:V-N (increase,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 87

          +---------------------------------------------------------------------------COMP:V-N(In)---------------------------------------------------------------------------+             
          |                     +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
          |                     |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
          |                     |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
          |                     |        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,proliferate)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 88

  +---------------------------------------------------------------------------------MOD:V-ADV--------------------------------------------------------------------------------+             
  |                             +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
  |                             |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
  |                             |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
  |                             |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
  |                    +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
  |                    |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD:V-ADV (__NODE__,in)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 89

  +---------------------------------------------------------------------------------MOD:V-ADV--------------------------------------------------------------------------------+             
  |                             +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
  |                             |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
  |                             |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
  |                             |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
  |                    +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
  |                    |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD:V-ADV (__NODE__,in)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 90

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 91

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 92

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                +---------------COMP:V-N(In)---------------+                                                    |                                            |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 93

          +---------------------------------------------------------------------------COMP:V-N(In)---------------------------------------------------------------------------+             
          |                     +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
          +-----------------------------------------------------COMP:V-N(In)----------------------------------------------------+                                            |             
          |                     |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
          +--------------------------COMP:V-N(In)--------------------------+                                                    |                                            |             
          |                     |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
          |                     |        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,proliferate)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,proliferate)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,proliferate)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 94

          +---------------------------------------------------------------------------COMP:V-N(In)---------------------------------------------------------------------------+             
          |                     +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
          +-----------------------------------------------------COMP:V-N(In)----------------------------------------------------+                                            |             
          |                     |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
          +--------------------------COMP:V-N(In)--------------------------+                                                    |                                            |             
          |                     |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
          |                     |        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,proliferate)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,proliferate)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,proliferate)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 95

  +---------------------------------------------------------------------------------MOD:V-ADV--------------------------------------------------------------------------------+             
  |                             +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
  +----------------------------------------------------------MOD:V-ADV----------------------------------------------------------+                                            |             
  |                             |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
  |                             |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
  |                             |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
  |                    +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
  |                    |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
MOD:V-ADV (contain,in)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD:V-ADV (__NODE__,in)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 96

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                +---------------COMP:V-N(In)---------------+                                                    |                                            |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 97

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                +---------------COMP:V-N(In)---------------+                                                    |                                            |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 98

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 99

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 100

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 101

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 102

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 103

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 104

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 105

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 106

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 107

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 108

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 109

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 110

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------------------APPOS---------------------------+                                                              |             
                                |                +----------------COMP:N-N(of)---------------+                |                 +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,CGTATTAACCACAATACTCG)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 111

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------------------APPOS-------------------------------+                                                              |             
                                |        +--------------------COMP:N-N(of)-------------------+                |                 +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
APPOS (__SP__,CGTATTAACCACAATACTCG)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 112

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 113

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 114

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 115

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 116

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------------------APPOS---------------------------+                                                              |             
                                |                +----------------COMP:N-N(of)---------------+                |                 +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,CGTATTAACCACAATACTCG)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 117

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------------------APPOS-------------------------------+                                                              |             
                                |        +--------------------COMP:N-N(of)-------------------+                |                 +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
APPOS (__SP__,CGTATTAACCACAATACTCG)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 118

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 119

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 120

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 121

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------------------APPOS---------------------------+                                                              |             
                                |                +----------------COMP:N-N(of)---------------+                |                 +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,CGTATTAACCACAATACTCG)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 122

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------------------APPOS---------------------------+                                                              |             
                                |                +----------------COMP:N-N(of)---------------+                |                 +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,CGTATTAACCACAATACTCG)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 123

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------------------APPOS-------------------------------+                                                              |             
                                |        +--------------------COMP:N-N(of)-------------------+                |                 +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
APPOS (__SP__,CGTATTAACCACAATACTCG)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 124

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------------------APPOS-------------------------------+                                                              |             
                                |        +--------------------COMP:N-N(of)-------------------+                |                 +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
APPOS (__SP__,CGTATTAACCACAATACTCG)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 125

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 126

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------------------APPOS---------------------------+                                                              |             
                                |                +----------------COMP:N-N(of)---------------+                |                 +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,CGTATTAACCACAATACTCG)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 127

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------------------APPOS---------------------------+                                                              |             
                                |                +----------------COMP:N-N(of)---------------+                |                 +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,CGTATTAACCACAATACTCG)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 128

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------------------APPOS-------------------------------+                                                              |             
                                |        +--------------------COMP:N-N(of)-------------------+                |                 +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
APPOS (__SP__,CGTATTAACCACAATACTCG)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 129

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------------------APPOS-------------------------------+                                                              |             
                                |        +--------------------COMP:N-N(of)-------------------+                |                 +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
APPOS (__SP__,CGTATTAACCACAATACTCG)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 130

                                                                                                                                +-----------------------OBJ:V-N----------------------+     
                                +-----------COMP:V-N(In)----------+        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |     
          +-----MOD_ATT:N-N-----+        +-MOD_ATT:N-ADJ-+        |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+     
          |            +MOD_ATT:+        |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:V-N(In) (increase,cell)
SUBJ:V-N (increase,protein)
OBJ:V-N (increase,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 131

                                                                                                                                +-----------------------OBJ:V-N----------------------+     
                                +-----------COMP:V-N(In)----------+        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |     
          +----MOD_ATT:N-ADJ----+        +-MOD_ATT:N-ADJ-+        |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+     
          |            +MOD_ATT:+        |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:V-N(In) (increase,cell)
SUBJ:V-N (increase,protein)
OBJ:V-N (increase,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 132

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+---------------OBJ:V-N--------------+       |             
                                +---------------COMP:V-N(In)---------------+                                                    +----------OBJ:V-N---------+         |       |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+           +------MOD_ATT:N-ADJ-----+       |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__SP__,__NODE__)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
OBJ:V-N (__NODE__,protein)

Analyse 133

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                +---------------COMP:V-N(In)---------------+                                                    +---------------OBJ:V-N--------------+       |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+         |       |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
OBJ:V-N (__NODE__,protein)

Analyse 134

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 135

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 136

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 137

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 138

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 139

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 140

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 141

                                                                  +------------------------------------------------------OBJ:V-N-----------------------------------------------------+     
                                +-----------COMP:V-N(In)----------+        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |     
          +-----MOD_ATT:N-N-----+        +-MOD_ATT:N-ADJ-+        |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+     
          |            +MOD_ATT:+        |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:V-N(In) (increase,cell)
SUBJ:V-N (increase,protein)
OBJ:V-N (increase,bind)
OBJ:V-N (increase,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 142

                                                                  +------------------------------------------------------OBJ:V-N-----------------------------------------------------+     
                                +-----------COMP:V-N(In)----------+        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |     
          +----MOD_ATT:N-ADJ----+        +-MOD_ATT:N-ADJ-+        |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+     
          |            +MOD_ATT:+        |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:V-N(In) (increase,cell)
SUBJ:V-N (increase,protein)
OBJ:V-N (increase,bind)
OBJ:V-N (increase,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 143

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +-------------------------------------------------------MOD_ATT:N-ADJ-------------------------------------------------------+       |             
                                |        |       +---------------------------------------------------MOD_ATT:N-ADJ---------------------------------------------------+       |             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                    |       |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         |       |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__SP__,__SP__)
MOD_ATT:N-ADJ (__SP__,__NODE__)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 144

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +-------------------------------------------------------MOD_ATT:N-ADJ-------------------------------------------------------+       |             
                                |        |       +---------------------------------------------------MOD_ATT:N-ADJ---------------------------------------------------+       |             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                    |       |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         |       |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__SP__,__SP__)
MOD_ATT:N-ADJ (__SP__,__NODE__)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 145

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +-------------------------------------------------------MOD_ATT:N-ADJ-------------------------------------------------------+       |             
                                |        |       +---------------------------------------------------MOD_ATT:N-ADJ---------------------------------------------------+       |             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                    |       |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         |       |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__SP__,__SP__)
MOD_ATT:N-ADJ (__SP__,__NODE__)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 146

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +-------------------------------------------------------MOD_ATT:N-ADJ-------------------------------------------------------+       |             
                                |        |       +---------------------------------------------------MOD_ATT:N-ADJ---------------------------------------------------+       |             
                                |        |       |                +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                    |       |             
                                +---------------COMP:V-N(In)---------------+                                                    |                                    |       |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+         |       |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__SP__,__SP__)
MOD_ATT:N-ADJ (__SP__,__NODE__)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 147

          +---------------------------------------------------------------------------COMP:V-N(In)---------------------------------------------------------------------------+             
          |                     +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
          |                     |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
          |                     |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
          |                     |        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,proliferate)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 148

          +---------------------------------------------------------------------------COMP:V-N(In)---------------------------------------------------------------------------+             
          |                     +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
          |                     |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
          |                     |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
          |                     |        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,proliferate)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 149

  +---------------------------------------------------------------------------------MOD:V-ADV--------------------------------------------------------------------------------+             
  |                             +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
  |                             |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
  |                             |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
  |                             |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
  |                    +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
  |                    |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD:V-ADV (__NODE__,in)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 150

  +---------------------------------------------------------------------------------MOD:V-ADV--------------------------------------------------------------------------------+             
  |                             +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
  |                             |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
  |                             |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
  |                             |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
  |                    +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
  |                    |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD:V-ADV (__NODE__,in)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 151

  +---------------------------------------------------------------------------------MOD:V-ADV--------------------------------------------------------------------------------+             
  |                             +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
  |                             |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
  |                             |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
  |                             |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
  |                    +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
  |                    |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD:V-ADV (__NODE__,in)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 152

  +---------------------------------------------------------------------------------MOD:V-ADV--------------------------------------------------------------------------------+             
  |                             +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
  |                             |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
  |                             |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
  |                             |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
  |                    +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
  |                    |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD:V-ADV (__NODE__,in)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 153

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 154

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 155

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 156

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 157

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                +---------------COMP:V-N(In)---------------+                                                    |                                            |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 158

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 159

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 160

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                +---------------COMP:V-N(In)---------------+                                                    |                                            |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 161

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 162

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 163

          +---------------------------------------------------------------------------COMP:V-N(In)---------------------------------------------------------------------------+             
          |                     +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
          +-----------------------------------------------------COMP:V-N(In)----------------------------------------------------+                                            |             
          |                     |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
          +--------------------------COMP:V-N(In)--------------------------+                                                    |                                            |             
          |                     |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
          |                     |        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,proliferate)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,proliferate)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,proliferate)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 164

          +---------------------------------------------------------------------------COMP:V-N(In)---------------------------------------------------------------------------+             
          |                     +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
          +-----------------------------------------------------COMP:V-N(In)----------------------------------------------------+                                            |             
          |                     |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
          +--------------------------COMP:V-N(In)--------------------------+                                                    |                                            |             
          |                     |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
          |                     |        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,proliferate)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,proliferate)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,proliferate)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 165

  +---------------------------------------------------------------------------------MOD:V-ADV--------------------------------------------------------------------------------+             
  |                             +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
  +----------------------------------------------------------MOD:V-ADV----------------------------------------------------------+                                            |             
  |                             |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
  |                             |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
  |                             |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
  |                    +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
  |                    |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
MOD:V-ADV (contain,in)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD:V-ADV (__NODE__,in)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 166

  +---------------------------------------------------------------------------------MOD:V-ADV--------------------------------------------------------------------------------+             
  |                             +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
  +----------------------------------------------------------MOD:V-ADV----------------------------------------------------------+                                            |             
  |                             |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
  |                             |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
  |                             |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
  |                    +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
  |                    |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
MOD:V-ADV (contain,in)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD:V-ADV (__NODE__,in)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 167

  +---------------------------------------------------------------------------------MOD:V-ADV--------------------------------------------------------------------------------+             
  |                             +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
  +----------------------------------------------------------MOD:V-ADV----------------------------------------------------------+                                            |             
  |                             |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
  |                             |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
  |                             |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
  |                    +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
  |                    |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
MOD:V-ADV (contain,in)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD:V-ADV (__NODE__,in)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 168

  +---------------------------------------------------------------------------------MOD:V-ADV--------------------------------------------------------------------------------+             
  |                             +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
  +----------------------------------------------------------MOD:V-ADV----------------------------------------------------------+                                            |             
  |                             |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
  |                             |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
  |                             |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
  |                    +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
  |                    |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
MOD:V-ADV (contain,in)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD:V-ADV (__NODE__,in)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 169

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                +---------------COMP:V-N(In)---------------+                                                    |                                            |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 170

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                +---------------COMP:V-N(In)---------------+                                                    |                                            |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 171

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 172

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 173

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 174

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 175

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 176

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 177

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 178

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 179

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 180

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 181

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 182

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 183

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 184

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 185

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 186

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 187

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 188

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 189

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 190

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------------------APPOS---------------------------+                                                              |             
                                |                +----------------COMP:N-N(of)---------------+                |                 +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,CGTATTAACCACAATACTCG)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 191

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------------------APPOS---------------------------+                                                              |             
                                |                +----------------COMP:N-N(of)---------------+                |                 +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,CGTATTAACCACAATACTCG)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 192

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------------------APPOS-------------------------------+                                                              |             
                                |        +--------------------COMP:N-N(of)-------------------+                |                 +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        +---------OBJ:V-N--------+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
APPOS (__SP__,CGTATTAACCACAATACTCG)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 193

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 194

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 195

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------------------APPOS-------------------------------+                                                              |             
                                |        +--------------------COMP:N-N(of)-------------------+                |                 +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        +---------OBJ:V-N--------+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
APPOS (__SP__,CGTATTAACCACAATACTCG)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 196

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------------------APPOS-------------------------------+                                                              |             
                                |        +--------------------COMP:N-N(of)-------------------+                |                 +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        +---------OBJ:V-N--------+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
APPOS (__SP__,CGTATTAACCACAATACTCG)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 197

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 198

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 199

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 200

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------------------APPOS---------------------------+                                                              |             
                                |                +----------------COMP:N-N(of)---------------+                |                 +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,CGTATTAACCACAATACTCG)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 201

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------------------APPOS-------------------------------+                                                              |             
                                |        +--------------------COMP:N-N(of)-------------------+                |                 +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        +---------OBJ:V-N--------+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
APPOS (__SP__,CGTATTAACCACAATACTCG)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 202

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 203

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 204

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 205

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------------------APPOS---------------------------+                                                              |             
                                |                +----------------COMP:N-N(of)---------------+                |                 +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,CGTATTAACCACAATACTCG)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 206

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------------------APPOS-------------------------------+                                                              |             
                                |        +--------------------COMP:N-N(of)-------------------+                |                 +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        +---------OBJ:V-N--------+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
APPOS (__SP__,CGTATTAACCACAATACTCG)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 207

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------------------APPOS-------------------------------+                                                              |             
                                |        +--------------------COMP:N-N(of)-------------------+                |                 +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        +---------OBJ:V-N--------+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
APPOS (__SP__,CGTATTAACCACAATACTCG)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 208

                                                                                                                                +-----------------------OBJ:V-N----------------------+     
                                +-----------COMP:V-N(In)----------+        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |     
          +-----MOD_ATT:N-N-----+        +-MOD_ATT:N-ADJ-+        |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+     
          |            +MOD_ATT:+        |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:V-N(In) (increase,cell)
SUBJ:V-N (increase,protein)
OBJ:V-N (increase,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 209

                                                                                                                                +-----------------------OBJ:V-N----------------------+     
                                +-----------COMP:V-N(In)----------+        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |     
          +-----MOD_ATT:N-N-----+        +-MOD_ATT:N-ADJ-+        |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+     
          |            +MOD_ATT:+        |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:V-N(In) (increase,cell)
SUBJ:V-N (increase,protein)
OBJ:V-N (increase,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 210

                                                                                                                                +-----------------------OBJ:V-N----------------------+     
                                +-----------COMP:V-N(In)----------+        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |     
          +-----MOD_ATT:N-N-----+        +-MOD_ATT:N-ADJ-+        |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+     
          |            +MOD_ATT:+        |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:V-N(In) (increase,cell)
SUBJ:V-N (increase,protein)
OBJ:V-N (increase,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 211

                                                                                                                                +-----------------------OBJ:V-N----------------------+     
                                +-----------COMP:V-N(In)----------+        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |     
          +-----MOD_ATT:N-N-----+        +-MOD_ATT:N-ADJ-+        |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+     
          |            +MOD_ATT:+        |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:V-N(In) (increase,cell)
SUBJ:V-N (increase,protein)
OBJ:V-N (increase,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 212

                                                                  +------------------------------------------------------OBJ:V-N-----------------------------------------------------+     
                                +-----------COMP:V-N(In)----------+        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |     
          +-----MOD_ATT:N-N-----+        +-MOD_ATT:N-ADJ-+        |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+     
          |            +MOD_ATT:+        |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:V-N(In) (increase,cell)
SUBJ:V-N (increase,protein)
OBJ:V-N (increase,bind)
OBJ:V-N (increase,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 213

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +-------------------------------------------------------MOD_ATT:N-ADJ-------------------------------------------------------+       |             
                                |        |       +---------------------------------------------------MOD_ATT:N-ADJ---------------------------------------------------+       |             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                    |       |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         |       |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__SP__,__SP__)
MOD_ATT:N-ADJ (__SP__,__NODE__)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 214

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +-------------------------------------------------------MOD_ATT:N-ADJ-------------------------------------------------------+       |             
                                |        |       +---------------------------------------------------MOD_ATT:N-ADJ---------------------------------------------------+       |             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                    |       |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         |       |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__SP__,__SP__)
MOD_ATT:N-ADJ (__SP__,__NODE__)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 215

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +-------------------------------------------------------MOD_ATT:N-ADJ-------------------------------------------------------+       |             
                                |        |       +---------------------------------------------------MOD_ATT:N-ADJ---------------------------------------------------+       |             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                    |       |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         |       |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__SP__,__SP__)
MOD_ATT:N-ADJ (__SP__,__NODE__)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 216

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +-------------------------------------------------------MOD_ATT:N-ADJ-------------------------------------------------------+       |             
                                |        |       +---------------------------------------------------MOD_ATT:N-ADJ---------------------------------------------------+       |             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                    |       |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         |       |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__SP__,__SP__)
MOD_ATT:N-ADJ (__SP__,__NODE__)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 217

  +---------------------------------------------------------------------------------MOD:V-ADV--------------------------------------------------------------------------------+             
  |                             +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
  |                             |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
  |                             |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
  |                             |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
  |                    +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
  |                    |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD:V-ADV (__NODE__,in)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 218

  +---------------------------------------------------------------------------------MOD:V-ADV--------------------------------------------------------------------------------+             
  |                             +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
  |                             |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
  |                             |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
  |                             |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
  |                    +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
  |                    |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD:V-ADV (__NODE__,in)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 219

          +---------------------------------------------------------------------------COMP:V-N(In)---------------------------------------------------------------------------+             
          |                     +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
          |                     |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
          |                     |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          |                     |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,proliferate)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 220

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 221

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 222

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 223

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 224

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 225

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 226

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 227

          +---------------------------------------------------------------------------COMP:V-N(In)---------------------------------------------------------------------------+             
          |                     +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
          +-----------------------------------------------------COMP:V-N(In)----------------------------------------------------+                                            |             
          |                     |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
          |                     |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          |                     |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,proliferate)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,proliferate)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 228

  +---------------------------------------------------------------------------------MOD:V-ADV--------------------------------------------------------------------------------+             
  |                             +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
  +----------------------------------------------------------MOD:V-ADV----------------------------------------------------------+                                            |             
  |                             |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
  |                             |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
  |                             |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
  |                    +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
  |                    |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
MOD:V-ADV (contain,in)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD:V-ADV (__NODE__,in)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 229

          +---------------------------------------------------------------------------COMP:V-N(In)---------------------------------------------------------------------------+             
          |                     +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
          +-----------------------------------------------------COMP:V-N(In)----------------------------------------------------+                                            |             
          |                     |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
          |                     |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          |                     |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,proliferate)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,proliferate)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 230

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 231

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 232

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 233

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 234

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 235

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 236

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 237

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 238

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 239

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 240

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------------------APPOS---------------------------+                                                              |             
                                |                +----------------COMP:N-N(of)---------------+                |                 +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,CGTATTAACCACAATACTCG)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 241

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------------------APPOS-------------------------------+                                                              |             
                                |        +--------------------COMP:N-N(of)-------------------+                |                 +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        +---------OBJ:V-N--------+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
APPOS (__SP__,CGTATTAACCACAATACTCG)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 242

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------------------APPOS-------------------------------+                                                              |             
                                |        +--------------------COMP:N-N(of)-------------------+                |                 +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        +---------OBJ:V-N--------+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
APPOS (__SP__,CGTATTAACCACAATACTCG)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 243

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 244

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 245

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 246

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 247

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------------------APPOS---------------------------+                                                              |             
                                |                +----------------COMP:N-N(of)---------------+                |                 +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,CGTATTAACCACAATACTCG)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 248

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------------------APPOS---------------------------+                                                              |             
                                |                +----------------COMP:N-N(of)---------------+                |                 +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,CGTATTAACCACAATACTCG)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 249

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------------------APPOS-------------------------------+                                                              |             
                                |        +--------------------COMP:N-N(of)-------------------+                |                 +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        +---------OBJ:V-N--------+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
APPOS (__SP__,CGTATTAACCACAATACTCG)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 250

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------------------APPOS-------------------------------+                                                              |             
                                |        +--------------------COMP:N-N(of)-------------------+                |                 +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        +---------OBJ:V-N--------+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
APPOS (__SP__,CGTATTAACCACAATACTCG)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 251

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 252

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 253

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 254

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 255

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------------------APPOS---------------------------+                                                              |             
                                |                +----------------COMP:N-N(of)---------------+                |                 +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,CGTATTAACCACAATACTCG)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 256

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------------------APPOS---------------------------+                                                              |             
                                |                +----------------COMP:N-N(of)---------------+                |                 +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,CGTATTAACCACAATACTCG)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 257

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------------------APPOS-------------------------------+                                                              |             
                                |        +--------------------COMP:N-N(of)-------------------+                |                 +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        +---------OBJ:V-N--------+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
APPOS (__SP__,CGTATTAACCACAATACTCG)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 258

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 259

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 260

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 261

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 262

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------------------APPOS---------------------------+                                                              |             
                                |                +----------------COMP:N-N(of)---------------+                |                 +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,CGTATTAACCACAATACTCG)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 263

                                                                                                                                +-----------------------OBJ:V-N----------------------+     
                                +-----------COMP:V-N(In)----------+        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |     
          +-----MOD_ATT:N-N-----+        +-MOD_ATT:N-ADJ-+        |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+     
          |            +MOD_ATT:+        |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:V-N(In) (increase,cell)
SUBJ:V-N (increase,protein)
OBJ:V-N (increase,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 264

                                                                  +------------------------------------------------------OBJ:V-N-----------------------------------------------------+     
                                +-----------COMP:V-N(In)----------+        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |     
          +-----MOD_ATT:N-N-----+        +-MOD_ATT:N-ADJ-+        |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+     
          |            +MOD_ATT:+        |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:V-N(In) (increase,cell)
SUBJ:V-N (increase,protein)
OBJ:V-N (increase,bind)
OBJ:V-N (increase,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 265

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +-------------------------------------------------------MOD_ATT:N-ADJ-------------------------------------------------------+       |             
                                |        |       +---------------------------------------------------MOD_ATT:N-ADJ---------------------------------------------------+       |             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                    |       |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         |       |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__SP__,__SP__)
MOD_ATT:N-ADJ (__SP__,__NODE__)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 266

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +-------------------------------------------------------MOD_ATT:N-ADJ-------------------------------------------------------+       |             
                                |        |       +---------------------------------------------------MOD_ATT:N-ADJ---------------------------------------------------+       |             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                    |       |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         |       |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__SP__,__SP__)
MOD_ATT:N-ADJ (__SP__,__NODE__)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 267

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +-------------------------------------------------------MOD_ATT:N-ADJ-------------------------------------------------------+       |             
                                |        |       +---------------------------------------------------MOD_ATT:N-ADJ---------------------------------------------------+       |             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                    |       |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         |       |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__SP__,__SP__)
MOD_ATT:N-ADJ (__SP__,__NODE__)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 268

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +-------------------------------------------------------MOD_ATT:N-ADJ-------------------------------------------------------+       |             
                                |        |       +---------------------------------------------------MOD_ATT:N-ADJ---------------------------------------------------+       |             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                    |       |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         |       |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__SP__,__SP__)
MOD_ATT:N-ADJ (__SP__,__NODE__)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 269

          +---------------------------------------------------------------------------COMP:V-N(In)---------------------------------------------------------------------------+             
          |                     +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
          |                     |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
          |                     |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          |                     |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,proliferate)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 270

          +---------------------------------------------------------------------------COMP:V-N(In)---------------------------------------------------------------------------+             
          |                     +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
          |                     |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
          |                     |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          |                     |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,proliferate)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 271

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 272

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 273

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 274

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 275

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 276

          +---------------------------------------------------------------------------COMP:V-N(In)---------------------------------------------------------------------------+             
          |                     +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
          +-----------------------------------------------------COMP:V-N(In)----------------------------------------------------+                                            |             
          |                     |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
          |                     |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          |                     |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,proliferate)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,proliferate)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 277

          +---------------------------------------------------------------------------COMP:V-N(In)---------------------------------------------------------------------------+             
          |                     +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
          +-----------------------------------------------------COMP:V-N(In)----------------------------------------------------+                                            |             
          |                     |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
          |                     |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          |                     |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,proliferate)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,proliferate)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 278

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 279

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 280

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 281

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 282

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 283

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 284

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 285

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +-------------------------------------------------------MOD_ATT:N-ADJ-------------------------------------------------------+       |             
                                |        |       +---------------------------------------------------MOD_ATT:N-ADJ---------------------------------------------------+       |             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                    |       |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         |       |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__SP__,__SP__)
MOD_ATT:N-ADJ (__SP__,__NODE__)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 286

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +-------------------------------------------------------MOD_ATT:N-ADJ-------------------------------------------------------+       |             
                                |        |       +---------------------------------------------------MOD_ATT:N-ADJ---------------------------------------------------+       |             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                    |       |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         |       |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__SP__,__SP__)
MOD_ATT:N-ADJ (__SP__,__NODE__)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 287

          +---------------------------------------------------------------------------COMP:V-N(In)---------------------------------------------------------------------------+             
          |                     +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
          |                     |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
          |                     |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          |                     |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,proliferate)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 288

          +---------------------------------------------------------------------------COMP:V-N(In)---------------------------------------------------------------------------+             
          |                     +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
          |                     |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
          |                     |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          |                     |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,proliferate)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 289

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 290

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 291

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 292

          +---------------------------------------------------------------------------COMP:V-N(In)---------------------------------------------------------------------------+             
          |                     +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
          +-----------------------------------------------------COMP:V-N(In)----------------------------------------------------+                                            |             
          |                     |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
          |                     |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          |                     |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,proliferate)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,proliferate)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 293

          +---------------------------------------------------------------------------COMP:V-N(In)---------------------------------------------------------------------------+             
          |                     +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
          +-----------------------------------------------------COMP:V-N(In)----------------------------------------------------+                                            |             
          |                     |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
          |                     |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          |                     |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,proliferate)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,proliferate)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 294

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 295

                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)