vers la météo de la validation par utilisateur

Ingenuity294


precedent - 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 - suivant

Phrase 45 - PMID ?

In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .


Non annotée
Je ne sais pas
Je n'ai pas trouvé d'analyse satisfaisante


Commentaires :

Analyse 0
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                +---------------COMP:V-N(In)---------------+                                                    +---------------OBJ:V-N--------------+       |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+         |       |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
OBJ:V-N (__NODE__,protein)

Analyse 1
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                +---------------COMP:V-N(In)---------------+                                                    +---------------OBJ:V-N--------------+       |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+         |       |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
OBJ:V-N (__NODE__,protein)

Analyse 2
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 3
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 4
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 5
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 6
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 7
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +-------------------------------------------------------MOD_ATT:N-ADJ-------------------------------------------------------+       |             
                                |        |       +---------------------------------------------------MOD_ATT:N-ADJ---------------------------------------------------+       |             
                                |        |       |                +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                    |       |             
                                +---------------COMP:V-N(In)---------------+                                                    |                                    |       |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+         |       |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__SP__,__SP__)
MOD_ATT:N-ADJ (__SP__,__NODE__)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 8
  +---------------------------------------------------------------------------------MOD:V-ADV--------------------------------------------------------------------------------+             
  |                             +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
  |                             |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
  |                             |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
  |                             |        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
  |                    +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
  |                    |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD:V-ADV (__NODE__,in)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 9
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                +---------------COMP:V-N(In)---------------+                                                    |                                            |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 10
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                +---------------COMP:V-N(In)---------------+                                                    |                                            |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 11
  +---------------------------------------------------------------------------------MOD:V-ADV--------------------------------------------------------------------------------+             
  |                             +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
  +----------------------------------------------------------MOD:V-ADV----------------------------------------------------------+                                            |             
  |                             |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
  +--------------------------------MOD:V-ADV-------------------------------+                                                    |                                            |             
  |                             |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
  |                             |        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
  |                    +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
  |                    |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
MOD:V-ADV (bind,in)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
MOD:V-ADV (contain,in)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD:V-ADV (__NODE__,in)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 12
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                +---------------COMP:V-N(In)---------------+                                                    |                                            |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 13
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 14
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 15
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 16
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 17
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 18
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 19
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 20
                                                                                                                                +-----------------------OBJ:V-N----------------------+     
                                +-----------COMP:V-N(In)----------+        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |     
          +----MOD_ATT:N-ADJ----+        +-MOD_ATT:N-ADJ-+        |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+     
          |            +MOD_ATT:+        |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:V-N(In) (increase,cell)
SUBJ:V-N (increase,protein)
OBJ:V-N (increase,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 21
                                                                                                                                +-----------------------OBJ:V-N----------------------+     
                                +-----------COMP:V-N(In)----------+        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |     
          +----MOD_ATT:N-ADJ----+        +-MOD_ATT:N-ADJ-+        |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+     
          |            +MOD_ATT:+        |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:V-N(In) (increase,cell)
SUBJ:V-N (increase,protein)
OBJ:V-N (increase,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 22
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+---------------OBJ:V-N--------------+       |             
                                +---------------COMP:V-N(In)---------------+                                                    +----------OBJ:V-N---------+         |       |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+           +------MOD_ATT:N-ADJ-----+       |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__SP__,__NODE__)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
OBJ:V-N (__NODE__,protein)

Analyse 23
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                +---------------COMP:V-N(In)---------------+                                                    +---------------OBJ:V-N--------------+       |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+         |       |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
OBJ:V-N (__NODE__,protein)

Analyse 24
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                +---------------COMP:V-N(In)---------------+                                                    +---------------OBJ:V-N--------------+       |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+         |       |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
OBJ:V-N (__NODE__,protein)

Analyse 25
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 26
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 27
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 28
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 29
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 30
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 31
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 32
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 33
                                                                  +------------------------------------------------------OBJ:V-N-----------------------------------------------------+     
                                +-----------COMP:V-N(In)----------+        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |     
          +----MOD_ATT:N-ADJ----+        +-MOD_ATT:N-ADJ-+        |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+     
          |            +MOD_ATT:+        |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:V-N(In) (increase,cell)
SUBJ:V-N (increase,protein)
OBJ:V-N (increase,bind)
OBJ:V-N (increase,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 34
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +-------------------------------------------------------MOD_ATT:N-ADJ-------------------------------------------------------+       |             
                                |        |       +---------------------------------------------------MOD_ATT:N-ADJ---------------------------------------------------+       |             
                                |        |       |                +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                    |       |             
                                +---------------COMP:V-N(In)---------------+                                                    |                                    |       |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+         |       |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__SP__,__SP__)
MOD_ATT:N-ADJ (__SP__,__NODE__)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 35
  +---------------------------------------------------------------------------------MOD:V-ADV--------------------------------------------------------------------------------+             
  |                             +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
  |                             |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
  |                             |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
  |                             |        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
  |                    +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
  |                    |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD:V-ADV (__NODE__,in)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 36
  +---------------------------------------------------------------------------------MOD:V-ADV--------------------------------------------------------------------------------+             
  |                             +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
  |                             |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
  |                             |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
  |                             |        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
  |                    +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
  |                    |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD:V-ADV (__NODE__,in)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 37
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                +---------------COMP:V-N(In)---------------+                                                    |                                            |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 38
  +---------------------------------------------------------------------------------MOD:V-ADV--------------------------------------------------------------------------------+             
  |                             +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
  +----------------------------------------------------------MOD:V-ADV----------------------------------------------------------+                                            |             
  |                             |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
  +--------------------------------MOD:V-ADV-------------------------------+                                                    |                                            |             
  |                             |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
  |                             |        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
  |                    +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
  |                    |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
MOD:V-ADV (bind,in)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
MOD:V-ADV (contain,in)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD:V-ADV (__NODE__,in)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 39
  +---------------------------------------------------------------------------------MOD:V-ADV--------------------------------------------------------------------------------+             
  |                             +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
  +----------------------------------------------------------MOD:V-ADV----------------------------------------------------------+                                            |             
  |                             |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
  +--------------------------------MOD:V-ADV-------------------------------+                                                    |                                            |             
  |                             |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
  |                             |        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
  |                    +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
  |                    |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
MOD:V-ADV (bind,in)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
MOD:V-ADV (contain,in)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD:V-ADV (__NODE__,in)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 40
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                +---------------COMP:V-N(In)---------------+                                                    |                                            |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 41
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 42
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 43
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 44
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 45
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 46
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 47
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 48
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 49
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 50
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------------------APPOS---------------------------+                                                              |             
                                |                +----------------COMP:N-N(of)---------------+                |                 +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,CGTATTAACCACAATACTCG)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 51
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------------------APPOS---------------------------+                                                              |             
                                |                +----------------COMP:N-N(of)---------------+                |                 +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,CGTATTAACCACAATACTCG)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 52
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------------------APPOS-------------------------------+                                                              |             
                                |        +--------------------COMP:N-N(of)-------------------+                |                 +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
APPOS (__SP__,CGTATTAACCACAATACTCG)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 53
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------------------APPOS-------------------------------+                                                              |             
                                |        +--------------------COMP:N-N(of)-------------------+                |                 +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
APPOS (__SP__,CGTATTAACCACAATACTCG)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 54
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 55
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 56
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 57
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------------------APPOS---------------------------+                                                              |             
                                |                +----------------COMP:N-N(of)---------------+                |                 +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,CGTATTAACCACAATACTCG)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 58
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------------------APPOS---------------------------+                                                              |             
                                |                +----------------COMP:N-N(of)---------------+                |                 +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,CGTATTAACCACAATACTCG)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 59
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------------------APPOS-------------------------------+                                                              |             
                                |        +--------------------COMP:N-N(of)-------------------+                |                 +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
APPOS (__SP__,CGTATTAACCACAATACTCG)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 60
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------------------APPOS-------------------------------+                                                              |             
                                |        +--------------------COMP:N-N(of)-------------------+                |                 +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
APPOS (__SP__,CGTATTAACCACAATACTCG)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 61
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 62
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 63
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 64
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 65
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------------------APPOS---------------------------+                                                              |             
                                |                +----------------COMP:N-N(of)---------------+                |                 +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,CGTATTAACCACAATACTCG)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 66
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------------------APPOS-------------------------------+                                                              |             
                                |        +--------------------COMP:N-N(of)-------------------+                |                 +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
APPOS (__SP__,CGTATTAACCACAATACTCG)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 67
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 68
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 69
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 70
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 71
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------------------APPOS---------------------------+                                                              |             
                                |                +----------------COMP:N-N(of)---------------+                |                 +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,CGTATTAACCACAATACTCG)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 72
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------------------APPOS---------------------------+                                                              |             
                                |                +----------------COMP:N-N(of)---------------+                |                 +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,CGTATTAACCACAATACTCG)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 73
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------------------APPOS-------------------------------+                                                              |             
                                |        +--------------------COMP:N-N(of)-------------------+                |                 +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
APPOS (__SP__,CGTATTAACCACAATACTCG)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 74
                                                                                                                                +-----------------------OBJ:V-N----------------------+     
                                +-----------COMP:V-N(In)----------+        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |     
          +----MOD_ATT:N-ADJ----+        +-MOD_ATT:N-ADJ-+        |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+     
          |            +MOD_ATT:+        |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:V-N(In) (increase,cell)
SUBJ:V-N (increase,protein)
OBJ:V-N (increase,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 75
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                |                                 |                                                             +---------------OBJ:V-N--------------+       |             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+----------OBJ:V-N---------+         |       |             
                                +---------------COMP:V-N(In)---------------+                                                    |           +------MOD_ATT:N-ADJ-----+       |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+           |       +--MOD_ATT:N-ADJ-+       |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__SP__,__NODE__)
MOD_ATT:N-ADJ (__SP__,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
OBJ:V-N (__NODE__,protein)

Analyse 76
                                                                                                                                +-----------------------OBJ:V-N----------------------+     
                                +-----------COMP:V-N(In)----------+        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |     
          +----MOD_ATT:N-ADJ----+        +-MOD_ATT:N-ADJ-+        |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+     
          |            +MOD_ATT:+        |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:V-N(In) (increase,cell)
SUBJ:V-N (increase,protein)
OBJ:V-N (increase,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 77
                                                                                                                                +-----------------------OBJ:V-N----------------------+     
                                +-----------COMP:V-N(In)----------+        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |     
          +----MOD_ATT:N-ADJ----+        +-MOD_ATT:N-ADJ-+        |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+     
          |            +MOD_ATT:+        |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:V-N(In) (increase,cell)
SUBJ:V-N (increase,protein)
OBJ:V-N (increase,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 78
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                +---------------COMP:V-N(In)---------------+                                                    +---------------OBJ:V-N--------------+       |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+         |       |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
OBJ:V-N (__NODE__,protein)

Analyse 79
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                +---------------COMP:V-N(In)---------------+                                                    +---------------OBJ:V-N--------------+       |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+         |       |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
OBJ:V-N (__NODE__,protein)

Analyse 80
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 81
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 82
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 83
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 84
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 85
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 86
                                                                  +------------------------------------------------------OBJ:V-N-----------------------------------------------------+     
                                +-----------COMP:V-N(In)----------+        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |     
          +----MOD_ATT:N-ADJ----+        +-MOD_ATT:N-ADJ-+        |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+     
          |            +MOD_ATT:+        |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:V-N(In) (increase,cell)
SUBJ:V-N (increase,protein)
OBJ:V-N (increase,bind)
OBJ:V-N (increase,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 87
          +---------------------------------------------------------------------------COMP:V-N(In)---------------------------------------------------------------------------+             
          |                     +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
          |                     |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
          |                     |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
          |                     |        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,proliferate)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 88
  +---------------------------------------------------------------------------------MOD:V-ADV--------------------------------------------------------------------------------+             
  |                             +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
  |                             |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
  |                             |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
  |                             |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
  |                    +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
  |                    |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD:V-ADV (__NODE__,in)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 89
  +---------------------------------------------------------------------------------MOD:V-ADV--------------------------------------------------------------------------------+             
  |                             +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
  |                             |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
  |                             |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
  |                             |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
  |                    +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
  |                    |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD:V-ADV (__NODE__,in)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 90
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 91
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 92
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                +---------------COMP:V-N(In)---------------+                                                    |                                            |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 93
          +---------------------------------------------------------------------------COMP:V-N(In)---------------------------------------------------------------------------+             
          |                     +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
          +-----------------------------------------------------COMP:V-N(In)----------------------------------------------------+                                            |             
          |                     |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
          +--------------------------COMP:V-N(In)--------------------------+                                                    |                                            |             
          |                     |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
          |                     |        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,proliferate)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,proliferate)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,proliferate)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 94
          +---------------------------------------------------------------------------COMP:V-N(In)---------------------------------------------------------------------------+             
          |                     +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
          +-----------------------------------------------------COMP:V-N(In)----------------------------------------------------+                                            |             
          |                     |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
          +--------------------------COMP:V-N(In)--------------------------+                                                    |                                            |             
          |                     |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
          |                     |        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,proliferate)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,proliferate)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,proliferate)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 95
  +---------------------------------------------------------------------------------MOD:V-ADV--------------------------------------------------------------------------------+             
  |                             +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
  +----------------------------------------------------------MOD:V-ADV----------------------------------------------------------+                                            |             
  |                             |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
  |                             |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
  |                             |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
  |                    +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
  |                    |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
MOD:V-ADV (contain,in)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD:V-ADV (__NODE__,in)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 96
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                +---------------COMP:V-N(In)---------------+                                                    |                                            |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 97
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                +---------------COMP:V-N(In)---------------+                                                    |                                            |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 98
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 99
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 100
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 101
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 102
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 103
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 104
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 105
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 106
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 107
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 108
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 109
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 110
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------------------APPOS---------------------------+                                                              |             
                                |                +----------------COMP:N-N(of)---------------+                |                 +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,CGTATTAACCACAATACTCG)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 111
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------------------APPOS-------------------------------+                                                              |             
                                |        +--------------------COMP:N-N(of)-------------------+                |                 +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
APPOS (__SP__,CGTATTAACCACAATACTCG)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 112
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 113
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 114
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 115
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 116
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------------------APPOS---------------------------+                                                              |             
                                |                +----------------COMP:N-N(of)---------------+                |                 +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,CGTATTAACCACAATACTCG)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 117
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------------------APPOS-------------------------------+                                                              |             
                                |        +--------------------COMP:N-N(of)-------------------+                |                 +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
APPOS (__SP__,CGTATTAACCACAATACTCG)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 118
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 119
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 120
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 121
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------------------APPOS---------------------------+                                                              |             
                                |                +----------------COMP:N-N(of)---------------+                |                 +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,CGTATTAACCACAATACTCG)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 122
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------------------APPOS---------------------------+                                                              |             
                                |                +----------------COMP:N-N(of)---------------+                |                 +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,CGTATTAACCACAATACTCG)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 123
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------------------APPOS-------------------------------+                                                              |             
                                |        +--------------------COMP:N-N(of)-------------------+                |                 +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
APPOS (__SP__,CGTATTAACCACAATACTCG)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 124
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------------------APPOS-------------------------------+                                                              |             
                                |        +--------------------COMP:N-N(of)-------------------+                |                 +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
APPOS (__SP__,CGTATTAACCACAATACTCG)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 125
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 126
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------------------APPOS---------------------------+                                                              |             
                                |                +----------------COMP:N-N(of)---------------+                |                 +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,CGTATTAACCACAATACTCG)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 127
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------------------APPOS---------------------------+                                                              |             
                                |                +----------------COMP:N-N(of)---------------+                |                 +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+------APPOS-----+-----OBJ:V-N----+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,CGTATTAACCACAATACTCG)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 128
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------------------APPOS-------------------------------+                                                              |             
                                |        +--------------------COMP:N-N(of)-------------------+                |                 +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
APPOS (__SP__,CGTATTAACCACAATACTCG)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 129
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------------------APPOS-------------------------------+                                                              |             
                                |        +--------------------COMP:N-N(of)-------------------+                |                 +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        +---------OBJ:V-N--------+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
APPOS (__SP__,CGTATTAACCACAATACTCG)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 130
                                                                                                                                +-----------------------OBJ:V-N----------------------+     
                                +-----------COMP:V-N(In)----------+        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |     
          +-----MOD_ATT:N-N-----+        +-MOD_ATT:N-ADJ-+        |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+     
          |            +MOD_ATT:+        |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:V-N(In) (increase,cell)
SUBJ:V-N (increase,protein)
OBJ:V-N (increase,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 131
                                                                                                                                +-----------------------OBJ:V-N----------------------+     
                                +-----------COMP:V-N(In)----------+        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |     
          +----MOD_ATT:N-ADJ----+        +-MOD_ATT:N-ADJ-+        |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+     
          |            +MOD_ATT:+        |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:V-N(In) (increase,cell)
SUBJ:V-N (increase,protein)
OBJ:V-N (increase,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 132
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+---------------OBJ:V-N--------------+       |             
                                +---------------COMP:V-N(In)---------------+                                                    +----------OBJ:V-N---------+         |       |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+           +------MOD_ATT:N-ADJ-----+       |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__SP__,__NODE__)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
OBJ:V-N (__NODE__,protein)

Analyse 133
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                +---------------COMP:V-N(In)---------------+                                                    +---------------OBJ:V-N--------------+       |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+         |       |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
OBJ:V-N (contain,__SP__)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
OBJ:V-N (__NODE__,protein)

Analyse 134
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 135
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 136
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 137
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 138
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 139
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 140
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 141
                                                                  +------------------------------------------------------OBJ:V-N-----------------------------------------------------+     
                                +-----------COMP:V-N(In)----------+        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |     
          +-----MOD_ATT:N-N-----+        +-MOD_ATT:N-ADJ-+        |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+     
          |            +MOD_ATT:+        |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:V-N(In) (increase,cell)
SUBJ:V-N (increase,protein)
OBJ:V-N (increase,bind)
OBJ:V-N (increase,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 142
                                                                  +------------------------------------------------------OBJ:V-N-----------------------------------------------------+     
                                +-----------COMP:V-N(In)----------+        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |     
          +----MOD_ATT:N-ADJ----+        +-MOD_ATT:N-ADJ-+        |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+     
          |            +MOD_ATT:+        |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:V-N(In) (increase,cell)
SUBJ:V-N (increase,protein)
OBJ:V-N (increase,bind)
OBJ:V-N (increase,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 143
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +-------------------------------------------------------MOD_ATT:N-ADJ-------------------------------------------------------+       |             
                                |        |       +---------------------------------------------------MOD_ATT:N-ADJ---------------------------------------------------+       |             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                    |       |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         |       |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__SP__,__SP__)
MOD_ATT:N-ADJ (__SP__,__NODE__)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 144
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +-------------------------------------------------------MOD_ATT:N-ADJ-------------------------------------------------------+       |             
                                |        |       +---------------------------------------------------MOD_ATT:N-ADJ---------------------------------------------------+       |             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                    |       |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         |       |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__SP__,__SP__)
MOD_ATT:N-ADJ (__SP__,__NODE__)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 145
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +-------------------------------------------------------MOD_ATT:N-ADJ-------------------------------------------------------+       |             
                                |        |       +---------------------------------------------------MOD_ATT:N-ADJ---------------------------------------------------+       |             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                    |       |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         |       |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__SP__,__SP__)
MOD_ATT:N-ADJ (__SP__,__NODE__)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 146
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +-------------------------------------------------------MOD_ATT:N-ADJ-------------------------------------------------------+       |             
                                |        |       +---------------------------------------------------MOD_ATT:N-ADJ---------------------------------------------------+       |             
                                |        |       |                +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                    |       |             
                                +---------------COMP:V-N(In)---------------+                                                    |                                    |       |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+         |       |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__SP__,__SP__)
MOD_ATT:N-ADJ (__SP__,__NODE__)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 147
          +---------------------------------------------------------------------------COMP:V-N(In)---------------------------------------------------------------------------+             
          |                     +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
          |                     |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
          |                     |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
          |                     |        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,proliferate)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 148
          +---------------------------------------------------------------------------COMP:V-N(In)---------------------------------------------------------------------------+             
          |                     +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
          |                     |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
          |                     |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
          |                     |        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,proliferate)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 149
  +---------------------------------------------------------------------------------MOD:V-ADV--------------------------------------------------------------------------------+             
  |                             +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
  |                             |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
  |                             |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
  |                             |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
  |                    +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
  |                    |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD:V-ADV (__NODE__,in)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 150
  +---------------------------------------------------------------------------------MOD:V-ADV--------------------------------------------------------------------------------+             
  |                             +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
  |                             |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
  |                             |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
  |                             |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
  |                    +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
  |                    |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD:V-ADV (__NODE__,in)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 151
  +---------------------------------------------------------------------------------MOD:V-ADV--------------------------------------------------------------------------------+             
  |                             +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
  |                             |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
  |                             |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
  |                             |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
  |                    +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
  |                    |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD:V-ADV (__NODE__,in)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 152
  +---------------------------------------------------------------------------------MOD:V-ADV--------------------------------------------------------------------------------+             
  |                             +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
  |                             |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
  |                             |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
  |                             |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
  |                    +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
  |                    |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD:V-ADV (__NODE__,in)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 153
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 154
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 155
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 156
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 157
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                +---------------COMP:V-N(In)---------------+                                                    |                                            |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 158
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 159
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 160
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                +---------------COMP:V-N(In)---------------+                                                    |                                            |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 161
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 162
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 163
          +---------------------------------------------------------------------------COMP:V-N(In)---------------------------------------------------------------------------+             
          |                     +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
          +-----------------------------------------------------COMP:V-N(In)----------------------------------------------------+                                            |             
          |                     |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
          +--------------------------COMP:V-N(In)--------------------------+                                                    |                                            |             
          |                     |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
          |                     |        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,proliferate)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,proliferate)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,proliferate)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 164
          +---------------------------------------------------------------------------COMP:V-N(In)---------------------------------------------------------------------------+             
          |                     +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
          +-----------------------------------------------------COMP:V-N(In)----------------------------------------------------+                                            |             
          |                     |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
          +--------------------------COMP:V-N(In)--------------------------+                                                    |                                            |             
          |                     |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
          |                     |        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,proliferate)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,proliferate)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,proliferate)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 165
  +---------------------------------------------------------------------------------MOD:V-ADV--------------------------------------------------------------------------------+             
  |                             +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
  +----------------------------------------------------------MOD:V-ADV----------------------------------------------------------+                                            |             
  |                             |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
  |                             |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
  |                             |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
  |                    +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
  |                    |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
MOD:V-ADV (contain,in)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD:V-ADV (__NODE__,in)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 166
  +---------------------------------------------------------------------------------MOD:V-ADV--------------------------------------------------------------------------------+             
  |                             +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
  +----------------------------------------------------------MOD:V-ADV----------------------------------------------------------+                                            |             
  |                             |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
  |                             |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
  |                             |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
  |                    +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
  |                    |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
MOD:V-ADV (contain,in)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD:V-ADV (__NODE__,in)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 167
  +---------------------------------------------------------------------------------MOD:V-ADV--------------------------------------------------------------------------------+             
  |                             +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
  +----------------------------------------------------------MOD:V-ADV----------------------------------------------------------+                                            |             
  |                             |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
  |                             |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
  |                             |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
  |                    +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
  |                    |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
MOD:V-ADV (contain,in)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD:V-ADV (__NODE__,in)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 168
  +---------------------------------------------------------------------------------MOD:V-ADV--------------------------------------------------------------------------------+             
  |                             +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
  +----------------------------------------------------------MOD:V-ADV----------------------------------------------------------+                                            |             
  |                             |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
  |                             |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
  |                             |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
  |                    +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
  |                    |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
MOD:V-ADV (contain,in)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD:V-ADV (__NODE__,in)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 169
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                +---------------COMP:V-N(In)---------------+                                                    |                                            |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 170
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                                 +-------------------------------------------------SUBJ:V-N-------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                +---------------COMP:V-N(In)---------------+                                                    |                                            |             
                                |        +------MOD_ATT:N-ADJ-----+---------------------------SUBJ:V-N--------------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
COMP:V-N(In) (bind,cell)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,increase)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,increase)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 171
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 172
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 173
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 174
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 175
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 176
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 177
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 178
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 179
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 180
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 181
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 182
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 183
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+                                                             +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 184
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 185
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +--------------APPOS--------------+                                                             +------------------SUBJ:V-N------------------+             
                                |        +------MOD_ATT:N-ADJ-----+-------------------APPOS-------------------+                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       +--MOD_ATT:N-ADJ-+-------COMP:N-N(of)-------+                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       +MOD_ATT:+SUBJ:V-N+          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,increase)
MOD_ATT:N-ADJ (increase,__SP__)
MOD_ATT:N-ADJ (increase,__NODE__)
MOD_ATT:N-N (increase,protein)
COMP:N-N(of) (increase,fragment)
APPOS (increase,CGTATTAACCACAATACTCG)
SUBJ:V-N (bind,increase)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 186
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 187
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 188
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 189
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 190
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------------------APPOS---------------------------+                                                              |             
                                |                +----------------COMP:N-N(of)---------------+                |                 +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,CGTATTAACCACAATACTCG)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 191
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------------------APPOS---------------------------+                                                              |             
                                |                +----------------COMP:N-N(of)---------------+                |                 +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,CGTATTAACCACAATACTCG)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 192
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------------------APPOS-------------------------------+                                                              |             
                                |        +--------------------COMP:N-N(of)-------------------+                |                 +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        +---------OBJ:V-N--------+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
APPOS (__SP__,CGTATTAACCACAATACTCG)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 193
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 194
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 195
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------------------APPOS-------------------------------+                                                              |             
                                |        +--------------------COMP:N-N(of)-------------------+                |                 +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        +---------OBJ:V-N--------+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
APPOS (__SP__,CGTATTAACCACAATACTCG)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 196
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------------------APPOS-------------------------------+                                                              |             
                                |        +--------------------COMP:N-N(of)-------------------+                |                 +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        +---------OBJ:V-N--------+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
APPOS (__SP__,CGTATTAACCACAATACTCG)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 197
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 198
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 199
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 200
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------------------APPOS---------------------------+                                                              |             
                                |                +----------------COMP:N-N(of)---------------+                |                 +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,CGTATTAACCACAATACTCG)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 201
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------------------APPOS-------------------------------+                                                              |             
                                |        +--------------------COMP:N-N(of)-------------------+                |                 +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        +---------OBJ:V-N--------+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
APPOS (__SP__,CGTATTAACCACAATACTCG)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 202
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 203
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 204
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 205
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------------------APPOS---------------------------+                                                              |             
                                |                +----------------COMP:N-N(of)---------------+                |                 +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,CGTATTAACCACAATACTCG)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 206
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------------------APPOS-------------------------------+                                                              |             
                                |        +--------------------COMP:N-N(of)-------------------+                |                 +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        +---------OBJ:V-N--------+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
APPOS (__SP__,CGTATTAACCACAATACTCG)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 207
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------------------APPOS-------------------------------+                                                              |             
                                |        +--------------------COMP:N-N(of)-------------------+                |                 +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        +---------OBJ:V-N--------+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
APPOS (__SP__,CGTATTAACCACAATACTCG)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 208
                                                                                                                                +-----------------------OBJ:V-N----------------------+     
                                +-----------COMP:V-N(In)----------+        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |     
          +-----MOD_ATT:N-N-----+        +-MOD_ATT:N-ADJ-+        |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+     
          |            +MOD_ATT:+        |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:V-N(In) (increase,cell)
SUBJ:V-N (increase,protein)
OBJ:V-N (increase,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 209
                                                                                                                                +-----------------------OBJ:V-N----------------------+     
                                +-----------COMP:V-N(In)----------+        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |     
          +-----MOD_ATT:N-N-----+        +-MOD_ATT:N-ADJ-+        |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+     
          |            +MOD_ATT:+        |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:V-N(In) (increase,cell)
SUBJ:V-N (increase,protein)
OBJ:V-N (increase,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 210
                                                                                                                                +-----------------------OBJ:V-N----------------------+     
                                +-----------COMP:V-N(In)----------+        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |     
          +-----MOD_ATT:N-N-----+        +-MOD_ATT:N-ADJ-+        |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+     
          |            +MOD_ATT:+        |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:V-N(In) (increase,cell)
SUBJ:V-N (increase,protein)
OBJ:V-N (increase,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 211
                                                                                                                                +-----------------------OBJ:V-N----------------------+     
                                +-----------COMP:V-N(In)----------+        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |     
          +-----MOD_ATT:N-N-----+        +-MOD_ATT:N-ADJ-+        |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+     
          |            +MOD_ATT:+        |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:V-N(In) (increase,cell)
SUBJ:V-N (increase,protein)
OBJ:V-N (increase,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 212
                                                                  +------------------------------------------------------OBJ:V-N-----------------------------------------------------+     
                                +-----------COMP:V-N(In)----------+        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |     
          +-----MOD_ATT:N-N-----+        +-MOD_ATT:N-ADJ-+        |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+     
          |            +MOD_ATT:+        |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:V-N(In) (increase,cell)
SUBJ:V-N (increase,protein)
OBJ:V-N (increase,bind)
OBJ:V-N (increase,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 213
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +-------------------------------------------------------MOD_ATT:N-ADJ-------------------------------------------------------+       |             
                                |        |       +---------------------------------------------------MOD_ATT:N-ADJ---------------------------------------------------+       |             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                    |       |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         |       |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__SP__,__SP__)
MOD_ATT:N-ADJ (__SP__,__NODE__)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 214
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +-------------------------------------------------------MOD_ATT:N-ADJ-------------------------------------------------------+       |             
                                |        |       +---------------------------------------------------MOD_ATT:N-ADJ---------------------------------------------------+       |             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                    |       |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         |       |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__SP__,__SP__)
MOD_ATT:N-ADJ (__SP__,__NODE__)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 215
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +-------------------------------------------------------MOD_ATT:N-ADJ-------------------------------------------------------+       |             
                                |        |       +---------------------------------------------------MOD_ATT:N-ADJ---------------------------------------------------+       |             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                    |       |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         |       |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__SP__,__SP__)
MOD_ATT:N-ADJ (__SP__,__NODE__)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 216
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +-------------------------------------------------------MOD_ATT:N-ADJ-------------------------------------------------------+       |             
                                |        |       +---------------------------------------------------MOD_ATT:N-ADJ---------------------------------------------------+       |             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                    |       |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         |       |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__SP__,__SP__)
MOD_ATT:N-ADJ (__SP__,__NODE__)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 217
  +---------------------------------------------------------------------------------MOD:V-ADV--------------------------------------------------------------------------------+             
  |                             +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
  |                             |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
  |                             |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
  |                             |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
  |                    +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
  |                    |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD:V-ADV (__NODE__,in)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 218
  +---------------------------------------------------------------------------------MOD:V-ADV--------------------------------------------------------------------------------+             
  |                             +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
  |                             |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
  |                             |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
  |                             |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
  |                    +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
  |                    |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD:V-ADV (__NODE__,in)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 219
          +---------------------------------------------------------------------------COMP:V-N(In)---------------------------------------------------------------------------+             
          |                     +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
          |                     |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
          |                     |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          |                     |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,proliferate)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 220
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 221
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 222
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 223
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 224
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 225
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 226
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 227
          +---------------------------------------------------------------------------COMP:V-N(In)---------------------------------------------------------------------------+             
          |                     +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
          +-----------------------------------------------------COMP:V-N(In)----------------------------------------------------+                                            |             
          |                     |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
          |                     |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          |                     |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,proliferate)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,proliferate)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 228
  +---------------------------------------------------------------------------------MOD:V-ADV--------------------------------------------------------------------------------+             
  |                             +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
  +----------------------------------------------------------MOD:V-ADV----------------------------------------------------------+                                            |             
  |                             |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
  |                             |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
  |                             |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
  |                    +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
  |                    |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
MOD:V-ADV (contain,in)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD:V-ADV (__NODE__,in)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 229
          +---------------------------------------------------------------------------COMP:V-N(In)---------------------------------------------------------------------------+             
          |                     +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
          +-----------------------------------------------------COMP:V-N(In)----------------------------------------------------+                                            |             
          |                     |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
          |                     |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          |                     |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,proliferate)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,proliferate)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 230
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 231
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 232
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 233
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 234
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 235
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 236
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +----MOD_ATT:N-ADJ----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 237
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 238
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 239
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 240
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------------------APPOS---------------------------+                                                              |             
                                |                +----------------COMP:N-N(of)---------------+                |                 +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,CGTATTAACCACAATACTCG)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 241
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------------------APPOS-------------------------------+                                                              |             
                                |        +--------------------COMP:N-N(of)-------------------+                |                 +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        +---------OBJ:V-N--------+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
APPOS (__SP__,CGTATTAACCACAATACTCG)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 242
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------------------APPOS-------------------------------+                                                              |             
                                |        +--------------------COMP:N-N(of)-------------------+                |                 +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        +---------OBJ:V-N--------+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
APPOS (__SP__,CGTATTAACCACAATACTCG)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 243
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 244
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 245
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 246
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 247
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------------------APPOS---------------------------+                                                              |             
                                |                +----------------COMP:N-N(of)---------------+                |                 +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,CGTATTAACCACAATACTCG)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 248
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------------------APPOS---------------------------+                                                              |             
                                |                +----------------COMP:N-N(of)---------------+                |                 +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,CGTATTAACCACAATACTCG)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 249
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------------------APPOS-------------------------------+                                                              |             
                                |        +--------------------COMP:N-N(of)-------------------+                |                 +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        +---------OBJ:V-N--------+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
APPOS (__SP__,CGTATTAACCACAATACTCG)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 250
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------------------APPOS-------------------------------+                                                              |             
                                |        +--------------------COMP:N-N(of)-------------------+                |                 +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        +---------OBJ:V-N--------+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
APPOS (__SP__,CGTATTAACCACAATACTCG)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 251
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 252
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 253
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 254
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 255
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------------------APPOS---------------------------+                                                              |             
                                |                +----------------COMP:N-N(of)---------------+                |                 +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,CGTATTAACCACAATACTCG)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 256
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------------------APPOS---------------------------+                                                              |             
                                |                +----------------COMP:N-N(of)---------------+                |                 +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,CGTATTAACCACAATACTCG)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 257
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------------------APPOS-------------------------------+                                                              |             
                                |        +--------------------COMP:N-N(of)-------------------+                |                 +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        +---------OBJ:V-N--------+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
APPOS (__SP__,CGTATTAACCACAATACTCG)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 258
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 259
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------COMP:N-N(of)---------------+                                  +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 260
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 261
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +--------------------COMP:N-N(of)-------------------+                                  +------------------SUBJ:V-N------------------+             
                                |        +-------------SUBJ:V-N------------+                 |                                  +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        +---------OBJ:V-N--------+        |                 |                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+--APPOS-+       +MOD_ATT+SUBJ:V-N+        |          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__SP__)
COMP:N-N(of) (__SP__,fragment)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (increase,__SP__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__SP__)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 262
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |                +----------------------------APPOS---------------------------+                                                              |             
                                |                +----------------COMP:N-N(of)---------------+                |                 +------------------SUBJ:V-N------------------+             
                                |                +---------SUBJ:V-N--------+                 |                |                 +----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+------APPOS-----+-----OBJ:V-N----+        |                 |                |                 |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        +MOD_ATT+       +SUBJ:V-N+        |          +MOD_AT+                |                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
APPOS (cell,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,fragment)
APPOS (__NODE__,CGTATTAACCACAATACTCG)
OBJ:V-N (increase,__NODE__)
SUBJ:V-N (increase,protein)
SUBJ:V-N (bind,__NODE__)
MOD_ATT:N-N (fragment,DNA)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,contain)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 263
                                                                                                                                +-----------------------OBJ:V-N----------------------+     
                                +-----------COMP:V-N(In)----------+        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |     
          +-----MOD_ATT:N-N-----+        +-MOD_ATT:N-ADJ-+        |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+     
          |            +MOD_ATT:+        |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:V-N(In) (increase,cell)
SUBJ:V-N (increase,protein)
OBJ:V-N (increase,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
OBJ:V-N (contain,protein)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 264
                                                                  +------------------------------------------------------OBJ:V-N-----------------------------------------------------+     
                                +-----------COMP:V-N(In)----------+        +----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                         |     
          +-----MOD_ATT:N-N-----+        +-MOD_ATT:N-ADJ-+        |        +---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         +-MOD_ATT:N-ADJ-+     
          |            +MOD_ATT:+        |       +MOD_ATT+SUBJ:V-N+-OBJ:V-N+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         |       +MOD_ATT+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
COMP:V-N(In) (increase,cell)
SUBJ:V-N (increase,protein)
OBJ:V-N (increase,bind)
OBJ:V-N (increase,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 265
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +-------------------------------------------------------MOD_ATT:N-ADJ-------------------------------------------------------+       |             
                                |        |       +---------------------------------------------------MOD_ATT:N-ADJ---------------------------------------------------+       |             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                    |       |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         |       |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__SP__,__SP__)
MOD_ATT:N-ADJ (__SP__,__NODE__)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 266
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +-------------------------------------------------------MOD_ATT:N-ADJ-------------------------------------------------------+       |             
                                |        |       +---------------------------------------------------MOD_ATT:N-ADJ---------------------------------------------------+       |             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                    |       |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         |       |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__SP__,__SP__)
MOD_ATT:N-ADJ (__SP__,__NODE__)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 267
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +-------------------------------------------------------MOD_ATT:N-ADJ-------------------------------------------------------+       |             
                                |        |       +---------------------------------------------------MOD_ATT:N-ADJ---------------------------------------------------+       |             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                    |       |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         |       |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__SP__,__SP__)
MOD_ATT:N-ADJ (__SP__,__NODE__)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 268
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +-------------------------------------------------------MOD_ATT:N-ADJ-------------------------------------------------------+       |             
                                |        |       +---------------------------------------------------MOD_ATT:N-ADJ---------------------------------------------------+       |             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                    |       |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         |       |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
MOD_ATT:N-ADJ (__SP__,__SP__)
MOD_ATT:N-ADJ (__SP__,__NODE__)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 269
          +---------------------------------------------------------------------------COMP:V-N(In)---------------------------------------------------------------------------+             
          |                     +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
          |                     |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
          |                     |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          |                     |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,proliferate)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 270
          +---------------------------------------------------------------------------COMP:V-N(In)---------------------------------------------------------------------------+             
          |                     +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
          |                     |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
          |                     |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          |                     |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,proliferate)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 271
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 272
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 273
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 274
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 275
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 276
          +---------------------------------------------------------------------------COMP:V-N(In)---------------------------------------------------------------------------+             
          |                     +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
          +-----------------------------------------------------COMP:V-N(In)----------------------------------------------------+                                            |             
          |                     |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
          |                     |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          |                     |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,proliferate)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,proliferate)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 277
          +---------------------------------------------------------------------------COMP:V-N(In)---------------------------------------------------------------------------+             
          |                     +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
          +-----------------------------------------------------COMP:V-N(In)----------------------------------------------------+                                            |             
          |                     |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
          |                     |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          |                     |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,proliferate)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,proliferate)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 278
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 279
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 280
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 281
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 282
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 283
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 284
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-ADJ (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 285
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +-------------------------------------------------------MOD_ATT:N-ADJ-------------------------------------------------------+       |             
                                |        |       +---------------------------------------------------MOD_ATT:N-ADJ---------------------------------------------------+       |             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                    |       |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         |       |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__SP__,__SP__)
MOD_ATT:N-ADJ (__SP__,__NODE__)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 286
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                |        +-------------------------------------------------------MOD_ATT:N-ADJ-------------------------------------------------------+       |             
                                |        |       +---------------------------------------------------MOD_ATT:N-ADJ---------------------------------------------------+       |             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                    |       |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+         |       |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+         |       |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
MOD_ATT:N-ADJ (__SP__,__SP__)
MOD_ATT:N-ADJ (__SP__,__NODE__)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 287
          +---------------------------------------------------------------------------COMP:V-N(In)---------------------------------------------------------------------------+             
          |                     +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
          |                     |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
          |                     |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          |                     |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,proliferate)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 288
          +---------------------------------------------------------------------------COMP:V-N(In)---------------------------------------------------------------------------+             
          |                     +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
          |                     |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
          |                     |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          |                     |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,proliferate)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 289
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 290
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 291
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 292
          +---------------------------------------------------------------------------COMP:V-N(In)---------------------------------------------------------------------------+             
          |                     +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
          +-----------------------------------------------------COMP:V-N(In)----------------------------------------------------+                                            |             
          |                     |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
          |                     |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          |                     |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,proliferate)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,proliferate)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 293
          +---------------------------------------------------------------------------COMP:V-N(In)---------------------------------------------------------------------------+             
          |                     +------------------------------------------------------------------SUBJ:V-N------------------------------------------------------------------+             
          +-----------------------------------------------------COMP:V-N(In)----------------------------------------------------+                                            |             
          |                     |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
          |                     |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          |                     |        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,proliferate)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,proliferate)
SUBJ:V-N (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 294
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)

Analyse 295
                                +----------------------------------------------------------------COMP:V-N(In)----------------------------------------------------------------+             
                                +------------------------------------------COMP:V-N(In)-----------------------------------------+                                            |             
                                |        +----------MOD_ATT:N-ADJ----------+---------------------------------------------SUBJ:V-N--------------------------------------------+             
                                |        |       +------MOD_ATT:N-ADJ------+----------------------SUBJ:V-N----------------------+----------OBJ:V-N---------+                 |             
          +-----MOD_ATT:N-N-----+        |       |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                                  |           +-MOD_ATT:N-ADJ+                 |             
          |            +MOD_ATT:+        |       |       |        +MOD_ATT:+          +MOD_AT+------APPOS-----+                 |           |       +MOD_AT+         +SUBJ:V-+OBJ:V-N+     
          |            |        |        |       |       |        |        |          |      |                |                 |           |       |      |         |       |       |     
 In proliferating endothelial cells , __SP__ __NODE__ protein increases binding of a DNA fragment ( CGTATTAACCACAATACTCG ) containing a __NODE__ binding site and __SP__ __NODE__ protein .
MOD_ATT:N-N (cell,proliferate)
MOD_ATT:N-ADJ (cell,endothelial)
MOD_ATT:N-ADJ (bind,__SP__)
MOD_ATT:N-ADJ (bind,__NODE__)
MOD_ATT:N-N (bind,protein)
MOD_ATT:N-N (bind,increase)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,CGTATTAACCACAATACTCG)
COMP:V-N(In) (contain,cell)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,site)
MOD_ATT:N-ADJ (site,__NODE__)
MOD_ATT:N-N (site,binding)
COMP:V-N(In) (__NODE__,cell)
SUBJ:V-N (__NODE__,bind)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)