vers la météo de la validation par utilisateur

Ingenuity190


precedent - 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 - suivant

Phrase 67 - PMID ?

In a system of purified components , vitamin D causes little or no change in binding of a DNA fragment ( AGCTCAGGTCAAGGAGGTCAG ) with a DNA endogenous promoter that has a Vitamin D response element and __NODE__ protein and a protein protein complex consisting of mutant __NODE__ ( C terminal truncation with its AF 2 transcription activation domain deleted ) and of mutant __NODE__ ( C terminal truncation with its AF 2 transcription activation domain deleted ) .


Non annotée
Je ne sais pas
Je n'ai pas trouvé d'analyse satisfaisante


Commentaires :

Analyse 0
                              +----------------------------COMP:N-N(of)----------------------------+                                                                                              +--------------------------SUBJ:V-N--------------------------+                                          +-----------------COMP:N-N(with)----------------+                                                      +-----------------COMP:N-N(with)----------------+              
                              |                           +--------------COMP:N-N(of)--------------+                                                                                              |            +--------------------SUBJ:V-N-------------------+                   +---------APPOS--------+                 +---------MOD_ATT:N-N---------+                               +---------APPOS--------+                 +---------MOD_ATT:N-N---------+              
         +----COMP:N-N(of)----+                           |                      +---COMP:N-N(of)--+                                      +---MOD_ATT:N-N---+                                     |            |                     +--MOD_ATT:N-N--+         +----COMP:N-N(of)---+      +--MOD_ATT:N-N--+                 |       +-----MOD_ATT:N-N-----+----------COMP:N-N(of)---------+      +--MOD_ATT:N-N--+                 |       +-----MOD_ATT:N-N-----+              
         |          +MOD_ATT:N+          +MOD_+SUBJ+OBJ:V-+            +COMP:N-N(+          +MOD_AT+------APPOS-----+                     |       +MOD_ATT:N+                             +MOD_ATT+            |                     |       +MOD_ATT+-SUBJ:V-N+           +MOD_ATT+      |     +MOD_ATT:N+                 |       |            +MOD_ATT:+SUBJ:V+                +MOD_ATT+      |     +MOD_ATT:N+                 |       |            +MOD_ATT:+SUBJ:V+       
         |          |         |          |    |    |      |            |         |          |      |                |                     |       |         |                             |       |            |                     |       |       |         |           |       |      |     |         |                 |       |            |        |      |                |       |      |     |         |                 |       |            |        |      |       
 In a system of purified components , vitamin D causes little or no change in binding of a DNA fragment ( AGCTCAGGTCAAGGAGGTCAG ) with a DNA endogenous promoter that has a Vitamin D response element and __NODE__ protein and a protein protein complex consisting of mutant __NODE__ ( C terminal truncation with its AF 2 transcription activation domain deleted ) and of mutant __NODE__ ( C terminal truncation with its AF 2 transcription activation domain deleted ) .
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)
COMP:N-N(of) (component,fragment)
MOD_ATT:N-N (D,vitamin)
SUBJ:V-N (cause,D)
OBJ:V-N (cause,little)
COMP:N-N(of) (little,fragment)
COMP:N-N(in) (change,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,AGCTCAGGTCAAGGAGGTCAG)
MOD_ATT:N-N (promoter,DNA)
MOD_ATT:N-ADJ (promoter,endogenous)
MOD_ATT:N-N (element,response)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,__NODE__)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,mutant)
APPOS (__NODE__,truncation)
MOD_ATT:N-N (truncation,C)
MOD_ATT:N-N (truncation,terminal)
COMP:N-N(with) (truncation,domain)
MOD_ATT:N-N (domain,2)
MOD_ATT:N-N (domain,transcription)
MOD_ATT:N-N (domain,activation)
COMP:N-N(of) (domain,__NODE__)
SUBJ:V_PASS-N (delete,domain)
MOD_ATT:N-ADJ (__NODE__,mutant)
APPOS (__NODE__,truncation)
MOD_ATT:N-N (truncation,C)
MOD_ATT:N-N (truncation,terminal)
COMP:N-N(with) (truncation,domain)
MOD_ATT:N-N (domain,2)
MOD_ATT:N-N (domain,transcription)
MOD_ATT:N-N (domain,activation)
SUBJ:V_PASS-N (delete,domain)

Analyse 1
                              +----------------------------COMP:N-N(of)----------------------------+                                                                                                                                                                                                                                                                                                                                                                            
                              +-------------------COMP:N-N(in)-------------------+                 |                                                                                                                                                                                                                                                                                                                                                                            
                              |                           +--------------COMP:N-N(of)--------------+                                                                                              +--------------------------SUBJ:V-N--------------------------+                                          +-----------------COMP:N-N(with)----------------+                                                      +-----------------COMP:N-N(with)----------------+              
                              |                           |            +--------COMP:N-N(of)-------+                                                                   +----------OBJ:V-N---------+                    +----------------SUBJ:V-N---------------+                                          |                 +---------MOD_ATT:N-N---------+                               +---------APPOS--------+                 +---------MOD_ATT:N-N---------+              
         +----COMP:N-N(of)----+                           +-----COMP:N-N(in)-----+                 |                                      +---MOD_ATT:N-N---+          |            +-MOD_ATT:N-N-+                    |             +--MOD_ATT:N-N--+         +----COMP:N-N(of)---+---------APPOS--------+                 |       +-----MOD_ATT:N-N-----+----------COMP:N-N(of)---------+      +--MOD_ATT:N-N--+                 |       +-----MOD_ATT:N-N-----+              
         |          +MOD_ATT:N+          +MOD_+SUBJ+OBJ:V-+            +COMP:N-N(+          +MOD_AT+------APPOS-----+                     |       +MOD_ATT:N+-SUBJ:V-N-+            |     +MOD_ATT+            +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+           +MOD_ATT+            +MOD_ATT:N+                 |       |            +MOD_ATT:+SUBJ:V+                +MOD_ATT+      |     +MOD_ATT:N+                 |       |            +MOD_ATT:+SUBJ:V+       
         |          |         |          |    |    |      |            |         |          |      |                |                     |       |         |          |            |     |       |            |       |             |       |       |         |           |       |            |         |                 |       |            |        |      |                |       |      |     |         |                 |       |            |        |      |       
 In a system of purified components , vitamin D causes little or no change in binding of a DNA fragment ( AGCTCAGGTCAAGGAGGTCAG ) with a DNA endogenous promoter that has a Vitamin D response element and __NODE__ protein and a protein protein complex consisting of mutant __NODE__ ( C terminal truncation with its AF 2 transcription activation domain deleted ) and of mutant __NODE__ ( C terminal truncation with its AF 2 transcription activation domain deleted ) .
COMP:N-N(of) (system,component)
MOD_ATT:N-ADJ (component,purify)
COMP:N-N(in) (component,bind)
COMP:N-N(of) (component,fragment)
MOD_ATT:N-N (D,vitamin)
SUBJ:V-N (cause,D)
OBJ:V-N (cause,little)
COMP:N-N(in) (little,bind)
COMP:N-N(of) (little,fragment)
COMP:N-N(in) (change,bind)
COMP:N-N(of) (change,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,AGCTCAGGTCAAGGAGGTCAG)
MOD_ATT:N-N (promoter,DNA)
MOD_ATT:N-ADJ (promoter,endogenous)
SUBJ:V-N (have,promoter)
OBJ:V-N (have,element)
MOD_ATT:N-N (element,D)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,element)
SUBJ:V-N (consist,protein)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,mutant)
APPOS (__NODE__,truncation)
MOD_ATT:N-ADJ (truncation,terminal)
COMP:N-N(with) (truncation,domain)
MOD_ATT:N-N (domain,2)
MOD_ATT:N-N (domain,transcription)
MOD_ATT:N-N (domain,activation)
COMP:N-N(of) (domain,__NODE__)
SUBJ:V_PASS-N (delete,domain)
MOD_ATT:N-ADJ (__NODE__,mutant)
APPOS (__NODE__,truncation)
MOD_ATT:N-N (truncation,C)
MOD_ATT:N-ADJ (truncation,terminal)
COMP:N-N(with) (truncation,domain)
MOD_ATT:N-N (domain,2)
MOD_ATT:N-N (domain,transcription)
MOD_ATT:N-N (domain,activation)
SUBJ:V_PASS-N (delete,domain)