vers la météo de la validation par utilisateur

Ingenuity186

precedent - 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 - suivant

Phrase 10 - PMID ?

In a nuclear fraction from Sf9 cells , binding of promoter fragment ( TGTTAGAGGGGCACAGGTCCAGTGGC ) from mutant __NODE__ gene(s) ( A?C G?T C 457A ) consisting of DR1 response element and a protein protein complex consisting of frog __NODE__ and of __SP__ __NODE__ is the same as binding of promoter fragment ( CATTCTGGGTCAAAGTTGATCCCCT ) from __NODE__ gene(s) consisting of DR1 response element and a protein protein complex consisting of frog __NODE__ and of __SP__ __NODE__ .


Non annotée
Je ne sais pas
Je n'ai pas trouvé d'analyse satisfaisante


Commentaires :
Analyse 0 
                                                                                                                                                                                                                                                                                                                                                                                                                                              +--------------COMP:N-N(of)--------------+     
                                                                                                                                                                                                                                                                                                                                                                   +---------------------------------SUBJ:V-N---------------------------------+          +---------MOD_ATT:N-N---------+     
                                                                                                            +---------MOD_ATT:N-ADJ--------+                              +------------------MOD_ATT:N-N------------------+----------------SUBJ:V-N----------------+                                                                                               |                                                +--MOD_ATT:N-N--+         |          |      +-----MOD_ATT:N-ADJ----+     
         +MOD_ATT:+          +---SUBJ:V-N--+           +MOD_ATT:+----MOD_ATT:N-N----+                       |       +MOD_ATT+---APPOS---+  +------COMP:N-N(of)-----+      |                     +MOD_ATT+       +MOD_ATT:N+          +MOD_AT+              +SUBJ:V-+                      +MOD_ATT:N-A+------------------------APPOS-----------------------+       |         +COMP:N-N(+                            |       +MOD_ATT+-SUBJ:V-N+          |      |              +MOD_ATT+     
         |        |          |             |           |        |                   |                       |       |       |           |  |                       |      |                     |       |       |         |          |      |              |       |                      |           |                                                    |       |         |         |                            |       |       |         |          |      |              |       |     
 In a nuclear fraction from Sf9 cells , binding of promoter fragment ( TGTTAGAGGGGCACAGGTCCAGTGGC ) from mutant __NODE__ gene(s) ( A?C G?T C 457A ) consisting of DR1 response element and a protein protein complex consisting of frog __NODE__ and of __SP__ __NODE__ is the same as binding of promoter fragment ( CATTCTGGGTCAAAGTTGATCCCCT ) from __NODE__ gene(s) consisting of DR1 response element and a protein protein complex consisting of frog __NODE__ and of __SP__ __NODE__ .
MOD_ATT:N-ADJ (fraction,nuclear)
SUBJ:V-N (bind,Sf9)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (TGTTAGAGGGGCACAGGTCCAGTGGC,fragment)
MOD_ATT:N-ADJ (gene(s),__NODE__)
APPOS (gene(s),G?T)
MOD_ATT:N-ADJ (C,mutant)
COMP:N-N(of) (C,DR1)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-N (consist,response)
MOD_ATT:N-N (consist,complex)
MOD_ATT:N-N (__NODE__,frog)
SUBJ:V-N (__NODE__,consist)
SUBJ:V-N (__NODE__,__SP__)
MOD_ATT:N-ADJ (promoter,bind)
APPOS (promoter,__NODE__)
COMP:N-N(of) (consist,DR1)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,gene(s))
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
MOD_ATT:N-ADJ (__NODE__,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)