In a nuclear fraction from H 4 II E cells , binding of promoter fragment containing a Coup __NODE__ binding site and a __NODE__ response element 1 and a __NODE__ response element 2 and a __NODE__ binding site from __NODE__(s) and __NODE__ protein is the same as binding of a DNA fragment ( CGTTGATGGTACAAAATGTTCTAGGGTAC ) containing a __NODE__ response element and __NODE__ protein .