In a cell free system , binding of a DNA fragment ( 5 ' AAAAACTGGGTGAAATGTGC 3 ' containing a __NODE__ response element from __SP__ __NODE__ gene __SP__ __NODE__ gene(s) and heterodimer consisting of frog __NODE__ and of __NODE__ is greater than binding of a DNA fragment ( 5 ' AAAAACTGGGCCAAAGGTCT 3 ' containing a __NODE__ response element from __SP__ __NODE__ gene(s) and heterodimer consisting of frog __NODE__ and of __NODE__ .