In a cell free system , binding of a DNA fragment ( AGCTCTTTGGTCACTCAAGTTCAAGT ) containing a __NODE__ response element from __SP__ __NODE__ gene and a protein protein complex consisting of __SP__ __NODE__ and of __SP__ __NODE__ is greater than binding of a DNA fragment ( AGCTTAATGACCTTGTTTATCCACTT ) containing a __NODE__ response element from __SP__ __NODE__ gene and a protein protein complex consisting of __SP__ __NODE__ and of __SP__ __NODE__ .