In a cell free system , binding of a DNA fragment ( GGACAAGCCCTGACAAGCCA ) from __SP__ __NODE__ and a protein protein complex consisting of dimeric __SP__ __NODE__ and of mutant dimeric __SP__ __NODE__ ( N terminal truncation ) is greater than binding of a DNA fragment ( GGACAAGCCCTGACAAGCCA ) from __SP__ __NODE__ and a protein protein complex consisting of mutant dimeric __SP__ __NODE__ ( X248W ) and of mutant dimeric __SP__ __NODE__ ( N terminal truncation ) .