vers la météo de la validation par utilisateur

Ingenuity175


precedent - 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 - suivant

Phrase 52 - PMID ?

In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .


Non annotée
Je ne sais pas
Je n'ai pas trouvé d'analyse satisfaisante


Commentaires :

Analyse 0
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 1
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 2
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 3
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 4
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 5
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 6
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     +------------------------------------------------------COMP:V-N(as)-----------------------------------------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 7
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     +------------------------------------------------------COMP:V-N(as)-----------------------------------------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 8
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     +------------------------------------------------------COMP:V-N(as)-----------------------------------------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 9
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   |        |                                                        |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 10
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   |        |                                                        |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 11
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 12
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 13
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 14
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                 +------------------------------------COMP:N-N(from)------------------------------------+     |       |                                                                                                                     
                   |        |                 |                                                    +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                 |         +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:N-N(from) (fragment,protein)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 15
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 16
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   |        |                                                                      +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 17
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       +-----------------------------SUBJ:V-N----------------------------+-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +----------------APPOS---------------+                   +-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                  |                   |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+                  |                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GATCCTGATCACGTGATCGAGGAG)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 18
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 19
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 20
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   |        |                                                        |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 21
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   |        |                                                        |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 22
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 23
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 24
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 25
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 26
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 27
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 28
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   |        |                                                                      +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 29
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   |        |                                                                      +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 30
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   |        |                                                        |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 31
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 32
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 33
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                 +------------------------------------COMP:N-N(from)------------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   |        |                 |                                                    +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        |                 |         +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:N-N(from) (fragment,protein)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 34
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 35
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   |        |                                                                      +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 36
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   |        |                                                                      +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 37
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       +-----------------------------SUBJ:V-N----------------------------+       |  +------------MOD_ATT:N-N-----------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +----------------APPOS---------------+                   |       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                  |                   |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+                  |                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GATCCTGATCACGTGATCGAGGAG)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 38
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 39
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   |        |                                                        |             +----------MOD_ATT:N-ADJ----------+     +------------------------------------------------------COMP:V-N(as)-----------------------------------------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 40
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     +------------------------------------------------------COMP:V-N(as)-----------------------------------------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 41
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                 +------------------------------------COMP:N-N(from)------------------------------------+     |       |                                                                                                                     
                   |        |                 |                                                    +----------MOD_ATT:N-ADJ----------+     +------------------------------------------------------COMP:V-N(as)-----------------------------------------------------+     
                   |        |                 |         +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:N-N(from) (fragment,protein)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 42
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   |        |                                                                      +----------MOD_ATT:N-ADJ----------+     +------------------------------------------------------COMP:V-N(as)-----------------------------------------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 43
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     +------------------------------------------------------COMP:V-N(as)-----------------------------------------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 44
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     +------------------------------------------------------COMP:V-N(as)-----------------------------------------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 45
                            +-------------------------------------------------------------------------------------------------------------MOD_PRED:N-N-------------------------------------------------------------------------------------------------------------+     
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                       |     
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                               |     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                               |     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                                                               |     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_PRED:N-N (bind,protein)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 46
                            +-------------------------------------------------------------------------------------------------------------MOD_PRED:N-N-------------------------------------------------------------------------------------------------------------+     
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                       |     
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                               |     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                               |     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |       +-----------------------------SUBJ:V-N----------------------------+                                             |     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +----------------APPOS---------------+                   +-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                  |                   |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+                  |                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_PRED:N-N (bind,protein)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GATCCTGATCACGTGATCGAGGAG)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 47
                            +-------------------------------------------------------------------------------------------------------------MOD_PRED:N-N-------------------------------------------------------------------------------------------------------------+     
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                       |     
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                               |     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                               |     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                                                               |     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_PRED:N-N (bind,protein)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 48
                            +-------------------------------------------------------------------------------------------------------------MOD_PRED:N-N-------------------------------------------------------------------------------------------------------------+     
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                       |     
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                               |     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                               |     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       +-----------------------------SUBJ:V-N----------------------------+                                             |     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +----------------APPOS---------------+                   +-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                  |                   |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+                  |                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_PRED:N-N (bind,protein)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GATCCTGATCACGTGATCGAGGAG)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 49
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   |        |                                                        |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 50
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 51
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   |        |                                                        |             +----------MOD_ATT:N-ADJ----------+     |       +-----------------------------SUBJ:V-N----------------------------+-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +----------------APPOS---------------+                   +-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                  |                   |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+                  |                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GATCCTGATCACGTGATCGAGGAG)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 52
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                                                                             
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |                                                                                                                             
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |                                                                         +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |                +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |                +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +-MOD:V-ADV-+OBJ:+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |           |    |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
MOD:V-ADV (be,as)
OBJ:V-N (as,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 53
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 54
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 55
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 56
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                 +------------------------------------COMP:N-N(from)------------------------------------+     |       |                                                                                                                     
                   |        |                 |                                                    +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                 |         +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:N-N(from) (fragment,protein)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 57
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     |       +-----------------------------SUBJ:V-N----------------------------+-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +----------------APPOS---------------+                   +-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                  |                   |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+                  |                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GATCCTGATCACGTGATCGAGGAG)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 58
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                                                                             
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |                                                                                                                             
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |                                                                         +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |                +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |                +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |                |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |                |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 59
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 60
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 61
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                 +------------------------------------COMP:N-N(from)------------------------------------+     |       |                                                                                                                     
                   |        |                 |                                                    +----------MOD_ATT:N-ADJ----------+     |       +-----------------------------SUBJ:V-N----------------------------+-------------------OBJ:V-N-------------------+     
                   |        |                 |         +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +----------------APPOS---------------+                   +-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                  |                   |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+                  |                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:N-N(from) (fragment,protein)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GATCCTGATCACGTGATCGAGGAG)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 62
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 63
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 64
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   |        |                                                        |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 65
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   |        |                                                        |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 66
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 67
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   |        |                                                        |             +----------MOD_ATT:N-ADJ----------+     |       +-----------------------------SUBJ:V-N----------------------------+-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +----------------APPOS---------------+                   +-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                  |                   |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+                  |                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GATCCTGATCACGTGATCGAGGAG)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 68
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 69
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 70
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 71
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     |       +-----------------------------SUBJ:V-N----------------------------+-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +----------------APPOS---------------+                   +-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                  |                   |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+                  |                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GATCCTGATCACGTGATCGAGGAG)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 72
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                                                                             
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |                                                                                                                             
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |                                                                         +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |                +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |                +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +-MOD:V-ADV-+OBJ:+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |           |    |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
MOD:V-ADV (be,as)
OBJ:V-N (as,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 73
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 74
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 75
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 76
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 77
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   |        |                                                                      +----------MOD_ATT:N-ADJ----------+     |       +-----------------------------SUBJ:V-N----------------------------+-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +----------------APPOS---------------+                   +-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                  |                   |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+                  |                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GATCCTGATCACGTGATCGAGGAG)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 78
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   |        |                                                        |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 79
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 80
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                 +------------------------------------COMP:N-N(from)------------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   |        |                 |                                                    +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        |                 |         +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:N-N(from) (fragment,protein)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 81
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   |        |                                                        |             +----------MOD_ATT:N-ADJ----------+     |       +-----------------------------SUBJ:V-N----------------------------+       |  +------------MOD_ATT:N-N-----------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +----------------APPOS---------------+                   |       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                  |                   |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+                  |                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GATCCTGATCACGTGATCGAGGAG)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 82
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                         +-------------------OBJ:V-N-------------------+     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |                                                                         |       +-------------MOD_ATT:N-N-------------+     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |                                                                         |       |  +------------MOD_ATT:N-N-----------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |                +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |                +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +-MOD:V-ADV-+OBJ:+          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |           |    |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
MOD:V-ADV (be,as)
OBJ:V-N (as,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 83
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 84
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 85
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 86
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                 +------------------------------------COMP:N-N(from)------------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   |        |                 |                                                    +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        |                 |         +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:N-N(from) (fragment,protein)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 87
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     |       +-----------------------------SUBJ:V-N----------------------------+       |  +------------MOD_ATT:N-N-----------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +----------------APPOS---------------+                   |       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                  |                   |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+                  |                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GATCCTGATCACGTGATCGAGGAG)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 88
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                         +-------------------OBJ:V-N-------------------+     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |                                                                         |       +-------------MOD_ATT:N-N-------------+     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |                                                                         |       |  +------------MOD_ATT:N-N-----------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |                +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |                +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +-MOD:V-ADV-+OBJ:+          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |           |    |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
MOD:V-ADV (be,as)
OBJ:V-N (as,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 89
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 90
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 91
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 92
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 93
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   |        |                                                                      +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 94
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 95
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 96
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     |       +--------------------------------------------------COMP:N-N(as)-------------------------------------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 97
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                 +------------------------------------COMP:N-N(from)------------------------------------+     |       |                                                                                                                     
                   |        |                 |                                                    +----------MOD_ATT:N-ADJ----------+     |       +--------------------------------------------------COMP:N-N(as)-------------------------------------------------+     
                   |        |                 |         +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:N-N(from) (fragment,protein)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 98
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                                                                             
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |                                                                                                                             
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     +------------------------------------------------------COMP:V-N(as)-----------------------------------------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |                +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |                +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |                |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |                |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
COMP:V-N(as) (be,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 99
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     +------------------------------------------------------COMP:V-N(as)-----------------------------------------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,bind)
COMP:V-N(as) (be,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 100
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     +------------------------------------------------------COMP:V-N(as)-----------------------------------------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,bind)
COMP:V-N(as) (be,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 101
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     +------------------------------------------------------COMP:V-N(as)-----------------------------------------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 102
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   |        |                                                                      +----------MOD_ATT:N-ADJ----------+     |       +--------------------------------------------------COMP:N-N(as)-------------------------------------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 103
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                                                                             
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |                                                                                                                             
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |           +--------------------------------------------------OBJ:V-N--------------------------------------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |           |    +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |           |    +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +-MOD:V-ADV-+OBJ:+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |           |    |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
MOD:V-ADV (be,as)
OBJ:V-N (as,bind)
OBJ:V-N (as,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 104
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                                                                             
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |                                                                                                                             
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     +------------------------------------------------------COMP:V-N(as)-----------------------------------------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |                +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |                +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |                |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |                |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
COMP:V-N(as) (be,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 105
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     +------------------------------------------------------COMP:V-N(as)-----------------------------------------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 106
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     +------------------------------------------------------COMP:V-N(as)-----------------------------------------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 107
                            +-------------------------------------------------------------------------------------------------------------MOD_PRED:N-N-------------------------------------------------------------------------------------------------------------+     
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                       |     
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                               |     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                               |     
                   |        |                                                        |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                                                               |     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_PRED:N-N (bind,protein)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 108
                            +-------------------------------------------------------------------------------------------------------------MOD_PRED:N-N-------------------------------------------------------------------------------------------------------------+     
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                       |     
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                               |     
                   |        |                 +------------------------------------COMP:N-N(from)------------------------------------+     |       |                                                                                                               |     
                   |        |                 |                                                    +----------MOD_ATT:N-ADJ----------+     |       |                                                                                                               |     
                   |        |                 |         +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_PRED:N-N (bind,protein)
MOD_ATT:N-N (fragment,DNA)
COMP:N-N(from) (fragment,protein)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 109
                            +-------------------------------------------------------------------------------------------------------------MOD_PRED:N-N-------------------------------------------------------------------------------------------------------------+     
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                       |     
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                               |     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                               |     
                   |        |                                                        |             +----------MOD_ATT:N-ADJ----------+     |       +-----------------------------SUBJ:V-N----------------------------+                                             |     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +----------------APPOS---------------+                   +-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                  |                   |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+                  |                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_PRED:N-N (bind,protein)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GATCCTGATCACGTGATCGAGGAG)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 110
                            +-------------------------------------------------------------------------------------------------------------MOD_PRED:N-N-------------------------------------------------------------------------------------------------------------+     
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                       |     
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                               |     
                   |        |                 +------------------------------------COMP:N-N(from)------------------------------------+     |       |                                                                                                               |     
                   |        |                 |                                                    +----------MOD_ATT:N-ADJ----------+     |       |                                                                                                               |     
                   |        |                 |         +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_PRED:N-N (bind,protein)
MOD_ATT:N-N (fragment,DNA)
COMP:N-N(from) (fragment,protein)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 111
                            +-------------------------------------------------------------------------------------------------------------MOD_PRED:N-N-------------------------------------------------------------------------------------------------------------+     
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                       |     
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                               |     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                               |     
                   |        |                                                                      +----------MOD_ATT:N-ADJ----------+     |       |                                                                                                               |     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_PRED:N-N (bind,protein)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 112
                            +-------------------------------------------------------------------------------------------------------------MOD_PRED:N-N-------------------------------------------------------------------------------------------------------------+     
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                       |     
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                               |     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                               |     
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     |       +-----------------------------SUBJ:V-N----------------------------+                                             |     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +----------------APPOS---------------+                   +-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                  |                   |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+                  |                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_PRED:N-N (bind,protein)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GATCCTGATCACGTGATCGAGGAG)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 113
                            +-------------------------------------------------------------------------------------------------------------MOD_PRED:N-N-------------------------------------------------------------------------------------------------------------+     
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                       |     
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                               |     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                               |     
                   |        |                                                                      +----------MOD_ATT:N-ADJ----------+     |       |                                                                                                               |     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_PRED:N-N (bind,protein)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 114
                            +-------------------------------------------------------------------------------------------------------------MOD_PRED:N-N-------------------------------------------------------------------------------------------------------------+     
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                       |     
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                               |     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                               |     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                                                               |     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_PRED:N-N (bind,protein)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 115
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                                                                             
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |                                                                                                                             
                   |        |                                                        |             +----------MOD_ATT:N-ADJ----------+     |                                                                         +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |                +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |                +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |                |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |                |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 116
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   |        |                                                        |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 117
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 118
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 119
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 120
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                                                                             
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |                                                                                                                             
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     |                                                                         +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |                +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |                +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +-MOD:V-ADV-+OBJ:+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |           |    |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
MOD:V-ADV (be,as)
OBJ:V-N (as,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 121
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                                                                             
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |                                                                                                                             
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     |                                                                         +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |                +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |                +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |                |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |                |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 122
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 123
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 124
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 125
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 126
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                                                                             
                   |        |                 +------------------------------------COMP:N-N(from)------------------------------------+     |                                                                                                                             
                   |        |                 |                                                    +----------MOD_ATT:N-ADJ----------+     |                                                                         +-------------------OBJ:V-N-------------------+     
                   |        |                 |         +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |                +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |                +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +-MOD:V-ADV-+OBJ:+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |           |    |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
COMP:N-N(from) (fragment,protein)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
MOD:V-ADV (be,as)
OBJ:V-N (as,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 127
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                                                                             
                   |        |                 +------------------------------------COMP:N-N(from)------------------------------------+     |                                                                                                                             
                   |        |                 |                                                    +----------MOD_ATT:N-ADJ----------+     |                                                                         +-------------------OBJ:V-N-------------------+     
                   |        |                 |         +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |                +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |                +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |                |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |                |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
COMP:N-N(from) (fragment,protein)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 128
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                 +------------------------------------COMP:N-N(from)------------------------------------+     |       |                                                                                                                     
                   |        |                 |                                                    +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                 |         +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:N-N(from) (fragment,protein)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 129
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                 +------------------------------------COMP:N-N(from)------------------------------------+     |       |                                                                                                                     
                   |        |                 |                                                    +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                 |         +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:N-N(from) (fragment,protein)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 130
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                 +------------------------------------COMP:N-N(from)------------------------------------+     |       |                                                                                                                     
                   |        |                 |                                                    +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                 |         +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:N-N(from) (fragment,protein)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 131
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                 +------------------------------------COMP:N-N(from)------------------------------------+     |       |                                                                                                                     
                   |        |                 |                                                    +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                 |         +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:N-N(from) (fragment,protein)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 132
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |       +-----------------------------SUBJ:V-N----------------------------+-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +----------------APPOS---------------+                   +-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                  |                   |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+                  |                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GATCCTGATCACGTGATCGAGGAG)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 133
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   |        |                                                                      +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 134
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   |        |                                                                      +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 135
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       +-------COMP:N-N(of)-------+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (same,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 136
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       +-----------------------------SUBJ:V-N----------------------------+-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +----------------APPOS---------------+                   +-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                  |                   |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+                  |                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GATCCTGATCACGTGATCGAGGAG)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 137
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |                                                                                                                             
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |                                                                         +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |                +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |                +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +-MOD:V-ADV-+OBJ:+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |           |    |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
MOD:V-ADV (be,as)
OBJ:V-N (as,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 138
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |                                                                                                                             
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |                                                                         +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |                +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |                +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |                |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |                |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 139
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 140
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 141
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 142
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                                                                             
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |                                                                                                                             
                   |        |                                                        |             +----------MOD_ATT:N-ADJ----------+     |                                                                         +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |                +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |                +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +-MOD:V-ADV-+OBJ:+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |           |    |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
MOD:V-ADV (be,as)
OBJ:V-N (as,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 143
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                                                                             
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |                                                                                                                             
                   |        |                                                        |             +----------MOD_ATT:N-ADJ----------+     |                                                                         +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |                +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |                +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |                |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |                |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 144
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   |        |                                                        |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 145
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   |        |                                                        |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 146
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 147
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 148
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                                                                             
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |                                                                                                                             
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     |                                                                         +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |                +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |                +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |                |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |                |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 149
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 150
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 151
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 152
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                                                                             
                   |        |                 +------------------------------------COMP:N-N(from)------------------------------------+     |                                                                                                                             
                   |        |                 |                                                    +----------MOD_ATT:N-ADJ----------+     |                                                                         +-------------------OBJ:V-N-------------------+     
                   |        |                 |         +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |                +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |                +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |                |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |                |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
COMP:N-N(from) (fragment,protein)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 153
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                 +------------------------------------COMP:N-N(from)------------------------------------+     |       |                                                                                                                     
                   |        |                 |                                                    +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                 |         +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:N-N(from) (fragment,protein)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 154
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                 +------------------------------------COMP:N-N(from)------------------------------------+     |       |                                                                                                                     
                   |        |                 |                                                    +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                 |         +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:N-N(from) (fragment,protein)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 155
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                 +------------------------------------COMP:N-N(from)------------------------------------+     |       |                                                                                                                     
                   |        |                 |                                                    +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                 |         +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:N-N(from) (fragment,protein)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 156
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                 +------------------------------------COMP:N-N(from)------------------------------------+     |       |                                                                                                                     
                   |        |                 |                                                    +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                 |         +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:N-N(from) (fragment,protein)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 157
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       +-------COMP:N-N(of)-------+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (same,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 158
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 159
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |                                                                                                                             
                   |        |                                                                      +----------MOD_ATT:N-ADJ----------+     |                                                                         +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |                +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |                +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +-MOD:V-ADV-+OBJ:+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |           |    |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
MOD:V-ADV (be,as)
OBJ:V-N (as,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 160
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |                                                                                                                             
                   |        |                                                                      +----------MOD_ATT:N-ADJ----------+     |                                                                         +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |                +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |                +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |                |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |                |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 161
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   |        |                                                                      +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 162
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   |        |                                                                      +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 163
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       +-------COMP:N-N(of)-------+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (same,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 164
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       +-----------------------------SUBJ:V-N----------------------------+-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +----------------APPOS---------------+                   +-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                  |                   |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+                  |                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GATCCTGATCACGTGATCGAGGAG)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 165
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 166
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 167
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 168
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                         +-------------------OBJ:V-N-------------------+     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |                                                                         |       +-------------MOD_ATT:N-N-------------+     
                   |        |                                                        |             +----------MOD_ATT:N-ADJ----------+     |                                                                         |       |  +------------MOD_ATT:N-N-----------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |                +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |                +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +-MOD:V-ADV-+OBJ:+          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |           |    |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
MOD:V-ADV (be,as)
OBJ:V-N (as,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 169
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                         +-------------------OBJ:V-N-------------------+     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |                                                                         |       +-------------MOD_ATT:N-N-------------+     
                   |        |                                                        |             +----------MOD_ATT:N-ADJ----------+     |                                                                         |       |  +------------MOD_ATT:N-N-----------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |                +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |                +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |                |          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |                |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 170
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   |        |                                                        |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 171
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   |        |                                                        |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 172
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 173
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                         +-------------------OBJ:V-N-------------------+     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |                                                                         |       +-------------MOD_ATT:N-N-------------+     
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     |                                                                         |       |  +------------MOD_ATT:N-N-----------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |                +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |                +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +-MOD:V-ADV-+OBJ:+          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |           |    |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
MOD:V-ADV (be,as)
OBJ:V-N (as,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 174
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                         +-------------------OBJ:V-N-------------------+     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |                                                                         |       +-------------MOD_ATT:N-N-------------+     
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     |                                                                         |       |  +------------MOD_ATT:N-N-----------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |                +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |                +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |                |          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |                |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 175
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 176
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                 +------------------------------------COMP:N-N(from)------------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   |        |                 |                                                    +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        |                 |         +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:N-N(from) (fragment,protein)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 177
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                 +------------------------------------COMP:N-N(from)------------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   |        |                 |                                                    +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        |                 |         +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:N-N(from) (fragment,protein)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 178
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       +-------COMP:N-N(of)-------+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (same,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 179
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 180
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 181
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |       +-----------------------------SUBJ:V-N----------------------------+       |  +------------MOD_ATT:N-N-----------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +----------------APPOS---------------+                   |       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                  |                   |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+                  |                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GATCCTGATCACGTGATCGAGGAG)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 182
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |       +-----------------------------SUBJ:V-N----------------------------+       |  +------------MOD_ATT:N-N-----------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +----------------APPOS---------------+                   |       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                  |                   |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+                  |                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GATCCTGATCACGTGATCGAGGAG)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 183
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                         +-------------------OBJ:V-N-------------------+     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |                                                                         |       +-------------MOD_ATT:N-N-------------+     
                   |        |                                                                      +----------MOD_ATT:N-ADJ----------+     |                                                                         |       |  +------------MOD_ATT:N-N-----------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |                +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |                +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |                |          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |                |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 184
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   |        |                                                                      +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 185
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   |        |                                                                      +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 186
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       +-------COMP:N-N(of)-------+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (same,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 187
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       +-----------------------------SUBJ:V-N----------------------------+       |  +------------MOD_ATT:N-N-----------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +----------------APPOS---------------+                   |       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                  |                   |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+                  |                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GATCCTGATCACGTGATCGAGGAG)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 188
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 189
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 190
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                                                                             
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |                                                                                                                             
                   |        |                                                        |             +----------MOD_ATT:N-ADJ----------+     |           +--------------------------------------------------OBJ:V-N--------------------------------------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |           |    +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |           |    +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +-MOD:V-ADV-+OBJ:+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |           |    |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
MOD:V-ADV (be,as)
OBJ:V-N (as,bind)
OBJ:V-N (as,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 191
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   |        |                                                        |             +----------MOD_ATT:N-ADJ----------+     +------------------------------------------------------COMP:V-N(as)-----------------------------------------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 192
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   |        |                                                        |             +----------MOD_ATT:N-ADJ----------+     +------------------------------------------------------COMP:V-N(as)-----------------------------------------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 193
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |       +--------------------------------------------------COMP:N-N(as)-------------------------------------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(as) (same,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 194
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                                                                             
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |                                                                                                                             
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     |           +--------------------------------------------------OBJ:V-N--------------------------------------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |           |    +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |           |    +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +-MOD:V-ADV-+OBJ:+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |           |    |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
MOD:V-ADV (be,as)
OBJ:V-N (as,bind)
OBJ:V-N (as,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 195
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                                                                             
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |                                                                                                                             
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     +------------------------------------------------------COMP:V-N(as)-----------------------------------------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |                +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |                +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |                |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |                |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
COMP:V-N(as) (be,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 196
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     +------------------------------------------------------COMP:V-N(as)-----------------------------------------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,bind)
COMP:V-N(as) (be,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 197
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                                                                             
                   |        |                 +------------------------------------COMP:N-N(from)------------------------------------+     |                                                                                                                             
                   |        |                 |                                                    +----------MOD_ATT:N-ADJ----------+     |           +--------------------------------------------------OBJ:V-N--------------------------------------------------+     
                   |        |                 |         +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |           |    +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |           |    +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +-MOD:V-ADV-+OBJ:+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |           |    |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
COMP:N-N(from) (fragment,protein)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
MOD:V-ADV (be,as)
OBJ:V-N (as,bind)
OBJ:V-N (as,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 198
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                                                                             
                   |        |                 +------------------------------------COMP:N-N(from)------------------------------------+     |                                                                                                                             
                   |        |                 |                                                    +----------MOD_ATT:N-ADJ----------+     +------------------------------------------------------COMP:V-N(as)-----------------------------------------------------+     
                   |        |                 |         +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |                +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |                +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |                |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |                |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
COMP:N-N(from) (fragment,protein)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
COMP:V-N(as) (be,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 199
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                 +------------------------------------COMP:N-N(from)------------------------------------+     |       |                                                                                                                     
                   |        |                 |                                                    +----------MOD_ATT:N-ADJ----------+     +------------------------------------------------------COMP:V-N(as)-----------------------------------------------------+     
                   |        |                 |         +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:N-N(from) (fragment,protein)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,bind)
COMP:V-N(as) (be,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 200
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                 +------------------------------------COMP:N-N(from)------------------------------------+     |       |                                                                                                                     
                   |        |                 |                                                    +----------MOD_ATT:N-ADJ----------+     +------------------------------------------------------COMP:V-N(as)-----------------------------------------------------+     
                   |        |                 |         +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:N-N(from) (fragment,protein)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,bind)
COMP:V-N(as) (be,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 201
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       +--------------------------------------------------COMP:N-N(as)-------------------------------------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(as) (same,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 202
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       +--------------------------------------------------COMP:N-N(as)-------------------------------------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 203
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   |        |                                                                      +----------MOD_ATT:N-ADJ----------+     +------------------------------------------------------COMP:V-N(as)-----------------------------------------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,bind)
COMP:V-N(as) (be,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 204
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   |        |                                                                      +----------MOD_ATT:N-ADJ----------+     +------------------------------------------------------COMP:V-N(as)-----------------------------------------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 205
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   |        |                                                                      +----------MOD_ATT:N-ADJ----------+     +------------------------------------------------------COMP:V-N(as)-----------------------------------------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 206
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |                                                                                                                             
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     +------------------------------------------------------COMP:V-N(as)-----------------------------------------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |                +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |                +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |                |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |                |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
COMP:V-N(as) (be,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 207
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     +------------------------------------------------------COMP:V-N(as)-----------------------------------------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,bind)
COMP:V-N(as) (be,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 208
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     +------------------------------------------------------COMP:V-N(as)-----------------------------------------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,bind)
COMP:V-N(as) (be,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 209
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     +------------------------------------------------------COMP:V-N(as)-----------------------------------------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 210
                            +-------------------------------------------------------------------------------------------------------------MOD_PRED:N-N-------------------------------------------------------------------------------------------------------------+     
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                       |     
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                               |     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                               |     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                                                               |     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_PRED:N-N (bind,protein)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 211
                            +-------------------------------------------------------------------------------------------------------------MOD_PRED:N-N-------------------------------------------------------------------------------------------------------------+     
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                       |     
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                               |     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                               |     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                                                               |     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_PRED:N-N (bind,protein)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 212
                            +-------------------------------------------------------------------------------------------------------------MOD_PRED:N-N-------------------------------------------------------------------------------------------------------------+     
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                       |     
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                               |     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                               |     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                                                               |     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_PRED:N-N (bind,protein)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 213
                            +-------------------------------------------------------------------------------------------------------------MOD_PRED:N-N-------------------------------------------------------------------------------------------------------------+     
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                       |     
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                               |     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                               |     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                                                               |     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_PRED:N-N (bind,protein)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 214
                            +-------------------------------------------------------------------------------------------------------------MOD_PRED:N-N-------------------------------------------------------------------------------------------------------------+     
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                       |     
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                               |     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                               |     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                                                               |     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       +-------COMP:N-N(of)-------+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_PRED:N-N (bind,protein)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (same,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 215
                            +-------------------------------------------------------------------------------------------------------------MOD_PRED:N-N-------------------------------------------------------------------------------------------------------------+     
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                       |     
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                               |     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                               |     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       +-----------------------------SUBJ:V-N----------------------------+                                             |     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +----------------APPOS---------------+                   +-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                  |                   |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+                  |                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_PRED:N-N (bind,protein)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GATCCTGATCACGTGATCGAGGAG)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 216
                            +-------------------------------------------------------------------------------------------------------------MOD_PRED:N-N-------------------------------------------------------------------------------------------------------------+     
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                       |     
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                               |     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                               |     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       +-----------------------------SUBJ:V-N----------------------------+                                             |     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +----------------APPOS---------------+                   +-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                  |                   |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+                  |                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_PRED:N-N (bind,protein)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GATCCTGATCACGTGATCGAGGAG)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 217
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   |        |                                                        |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 218
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   |        |                                                        |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       +-------COMP:N-N(of)-------+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (same,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 219
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 220
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 221
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                 +------------------------------------COMP:N-N(from)------------------------------------+     |       |                                                                                                                     
                   |        |                 |                                                    +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                 |         +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:N-N(from) (fragment,protein)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 222
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                 +------------------------------------COMP:N-N(from)------------------------------------+     |       |                                                                                                                     
                   |        |                 |                                                    +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                 |         +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:N-N(from) (fragment,protein)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 223
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   |        |                                                        |             +----------MOD_ATT:N-ADJ----------+     |       +-----------------------------SUBJ:V-N----------------------------+-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +----------------APPOS---------------+                   +-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                  |                   |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+                  |                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GATCCTGATCACGTGATCGAGGAG)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 224
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                                                                             
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |                                                                                                                             
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |                                                                         +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |                +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |                +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +-MOD:V-ADV-+OBJ:+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |           |    |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
MOD:V-ADV (be,as)
OBJ:V-N (as,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 225
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                                                                             
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |                                                                                                                             
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |                                                                         +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |                +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |                +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |                |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
COMP:V-N(as) (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 226
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 227
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 228
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   |        |                                                        |             +----------MOD_ATT:N-ADJ----------+     |       +-----------------------------SUBJ:V-N----------------------------+-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +----------------APPOS---------------+                   +-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                  |                   |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+                  |                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GATCCTGATCACGTGATCGAGGAG)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 229
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 230
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 231
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                 +------------------------------------COMP:N-N(from)------------------------------------+     |       |                                                                                                                     
                   |        |                 |                                                    +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                 |         +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:N-N(from) (fragment,protein)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 232
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                 +------------------------------------COMP:N-N(from)------------------------------------+     |       |                                                                                                                     
                   |        |                 |                                                    +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                 |         +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:N-N(from) (fragment,protein)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 233
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       +-------COMP:N-N(of)-------+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (same,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 234
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                 +------------------------------------COMP:N-N(from)------------------------------------+     |       |                                                                                                                     
                   |        |                 |                                                    +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                 |         +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       +-------COMP:N-N(of)-------+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:N-N(from) (fragment,protein)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (same,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 235
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     |       +-----------------------------SUBJ:V-N----------------------------+-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +----------------APPOS---------------+                   +-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                  |                   |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+                  |                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GATCCTGATCACGTGATCGAGGAG)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 236
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                                                                             
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |                                                                                                                             
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |                                                                         +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |                +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |                +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |                |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
COMP:V-N(as) (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 237
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     |       +-----------------------------SUBJ:V-N----------------------------+-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +----------------APPOS---------------+                   +-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                  |                   |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+                  |                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GATCCTGATCACGTGATCGAGGAG)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 238
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                                                                             
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |                                                                                                                             
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |                                                                         +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |                +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |                +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |                |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |                |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 239
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                 +------------------------------------COMP:N-N(from)------------------------------------+     |       |                                                                                                                     
                   |        |                 |                                                    +----------MOD_ATT:N-ADJ----------+     |       +-----------------------------SUBJ:V-N----------------------------+-------------------OBJ:V-N-------------------+     
                   |        |                 |         +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +----------------APPOS---------------+                   +-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                  |                   |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+                  |                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:N-N(from) (fragment,protein)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GATCCTGATCACGTGATCGAGGAG)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 240
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   |        |                                                                      +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 241
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 242
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   |        |                                                                      +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       +-------COMP:N-N(of)-------+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (same,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 243
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 244
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 245
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   |        |                                                                      +----------MOD_ATT:N-ADJ----------+     |       +-----------------------------SUBJ:V-N----------------------------+-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +----------------APPOS---------------+                   +-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                  |                   |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+                  |                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GATCCTGATCACGTGATCGAGGAG)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 246
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       +-----------------------------SUBJ:V-N----------------------------+-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +----------------APPOS---------------+                   +-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                  |                   |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+                  |                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GATCCTGATCACGTGATCGAGGAG)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 247
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   |        |                                                        |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 248
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   |        |                                                        |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       +-------COMP:N-N(of)-------+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (same,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 249
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 250
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 251
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                 +------------------------------------COMP:N-N(from)------------------------------------+     |       |                                                                                                                     
                   |        |                 |                                                    +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                 |         +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:N-N(from) (fragment,protein)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 252
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                 +------------------------------------COMP:N-N(from)------------------------------------+     |       |                                                                                                                     
                   |        |                 |                                                    +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                 |         +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:N-N(from) (fragment,protein)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 253
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   |        |                                                        |             +----------MOD_ATT:N-ADJ----------+     |       +-----------------------------SUBJ:V-N----------------------------+-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +----------------APPOS---------------+                   +-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                  |                   |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+                  |                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GATCCTGATCACGTGATCGAGGAG)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 254
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                                                                             
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |                                                                                                                             
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |                                                                         +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |                +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |                +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +-MOD:V-ADV-+OBJ:+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |           |    |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
MOD:V-ADV (be,as)
OBJ:V-N (as,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 255
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 256
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   |        |                                                        |             +----------MOD_ATT:N-ADJ----------+     |       +-----------------------------SUBJ:V-N----------------------------+-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +----------------APPOS---------------+                   +-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                  |                   |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+                  |                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GATCCTGATCACGTGATCGAGGAG)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 257
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                                                                             
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |                                                                                                                             
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |                                                                         +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |                +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |                +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +-MOD:V-ADV-+OBJ:+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |           |    |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
MOD:V-ADV (be,as)
OBJ:V-N (as,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 258
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                                                                             
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |                                                                                                                             
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |                                                                         +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |                +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |                +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |                |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |                |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 259
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                 +------------------------------------COMP:N-N(from)------------------------------------+     |       |                                                                                                                     
                   |        |                 |                                                    +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                 |         +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:N-N(from) (fragment,protein)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 260
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                 +------------------------------------COMP:N-N(from)------------------------------------+     |       |                                                                                                                     
                   |        |                 |                                                    +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                 |         +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:N-N(from) (fragment,protein)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 261
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   |        |                                                                      +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 262
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                                                                             
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |                                                                                                                             
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |                                                                         +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |                +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |                +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +-MOD:V-ADV-+OBJ:+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |           |    |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
MOD:V-ADV (be,as)
OBJ:V-N (as,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 263
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     |       +-----------------------------SUBJ:V-N----------------------------+-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +----------------APPOS---------------+                   +-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                  |                   |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+                  |                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GATCCTGATCACGTGATCGAGGAG)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 264
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                                                                             
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |                                                                                                                             
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |                                                                         +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |                +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |                +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +-MOD:V-ADV-+OBJ:+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |           |    |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
MOD:V-ADV (be,as)
OBJ:V-N (as,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 265
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 266
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                 +------------------------------------COMP:N-N(from)------------------------------------+     |       |                                                                                                                     
                   |        |                 |                                                    +----------MOD_ATT:N-ADJ----------+     |       +-----------------------------SUBJ:V-N----------------------------+-------------------OBJ:V-N-------------------+     
                   |        |                 |         +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +----------------APPOS---------------+                   +-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                  |                   |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+                  |                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:N-N(from) (fragment,protein)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GATCCTGATCACGTGATCGAGGAG)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 267
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   |        |                                                                      +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 268
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   |        |                                                                      +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 269
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                 +------------------------------------COMP:N-N(from)------------------------------------+     |       |                                                                                                                     
                   |        |                 |                                                    +----------MOD_ATT:N-ADJ----------+     |       +-----------------------------SUBJ:V-N----------------------------+-------------------OBJ:V-N-------------------+     
                   |        |                 |         +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +----------------APPOS---------------+                   +-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                  |                   |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+                  |                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:N-N(from) (fragment,protein)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GATCCTGATCACGTGATCGAGGAG)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 270
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 271
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   |        |                                                                      +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       +-------COMP:N-N(of)-------+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (same,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 272
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   |        |                                                                      +----------MOD_ATT:N-ADJ----------+     |       +-----------------------------SUBJ:V-N----------------------------+-------------------OBJ:V-N-------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +----------------APPOS---------------+                   +-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                  |                   |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+                  |                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GATCCTGATCACGTGATCGAGGAG)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 273
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 274
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       +-------COMP:N-N(of)-------+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (same,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 275
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   |        |                                                        |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 276
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   |        |                                                        |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 277
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       +-----------------------------SUBJ:V-N----------------------------+-------------------OBJ:V-N-------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +----------------APPOS---------------+                   +-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                  |                   |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+                  |                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GATCCTGATCACGTGATCGAGGAG)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 278
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   |        |                                                        |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       +-------COMP:N-N(of)-------+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (same,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 279
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                 +------------------------------------COMP:N-N(from)------------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   |        |                 |                                                    +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        |                 |         +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:N-N(from) (fragment,protein)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 280
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   |        |                                                        |             +----------MOD_ATT:N-ADJ----------+     |       +-----------------------------SUBJ:V-N----------------------------+       |  +------------MOD_ATT:N-N-----------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +----------------APPOS---------------+                   |       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                  |                   |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+                  |                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GATCCTGATCACGTGATCGAGGAG)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 281
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                         +-------------------OBJ:V-N-------------------+     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |                                                                         |       +-------------MOD_ATT:N-N-------------+     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |                                                                         |       |  +------------MOD_ATT:N-N-----------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |                +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |                +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +-MOD:V-ADV-+OBJ:+          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |           |    |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
MOD:V-ADV (be,as)
OBJ:V-N (as,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 282
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                         +-------------------OBJ:V-N-------------------+     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |                                                                         |       +-------------MOD_ATT:N-N-------------+     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |                                                                         |       |  +------------MOD_ATT:N-N-----------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |                +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |                +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |                |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
COMP:V-N(as) (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 283
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 284
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 285
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                         +-------------------OBJ:V-N-------------------+     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |                                                                         |       +-------------MOD_ATT:N-N-------------+     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |                                                                         |       |  +------------MOD_ATT:N-N-----------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |                +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |                +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |                |          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |                |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 286
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 287
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 288
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                 +------------------------------------COMP:N-N(from)------------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   |        |                 |                                                    +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        |                 |         +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:N-N(from) (fragment,protein)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 289
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                 +------------------------------------COMP:N-N(from)------------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   |        |                 |                                                    +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        |                 |         +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:N-N(from) (fragment,protein)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 290
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       +-------COMP:N-N(of)-------+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (same,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 291
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                 +------------------------------------COMP:N-N(from)------------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   |        |                 |                                                    +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        |                 |         +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       +-------COMP:N-N(of)-------+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:N-N(from) (fragment,protein)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (same,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 292
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     |       +-----------------------------SUBJ:V-N----------------------------+       |  +------------MOD_ATT:N-N-----------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +----------------APPOS---------------+                   |       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                  |                   |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+                  |                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GATCCTGATCACGTGATCGAGGAG)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 293
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                         +-------------------OBJ:V-N-------------------+     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |                                                                         |       +-------------MOD_ATT:N-N-------------+     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |                                                                         |       |  +------------MOD_ATT:N-N-----------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |                +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |                +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +-MOD:V-ADV-+OBJ:+          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |           |    |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
MOD:V-ADV (be,as)
OBJ:V-N (as,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 294
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                         +-------------------OBJ:V-N-------------------+     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |                                                                         |       +-------------MOD_ATT:N-N-------------+     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |                                                                         |       |  +------------MOD_ATT:N-N-----------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |                +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |                +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |                |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
COMP:V-N(as) (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 295
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                         +-------------------OBJ:V-N-------------------+     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |                                                                         |       +-------------MOD_ATT:N-N-------------+     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |                                                                         |       |  +------------MOD_ATT:N-N-----------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |                +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |                +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +-MOD:V-ADV-+OBJ:+          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |           |    |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
MOD:V-ADV (be,as)
OBJ:V-N (as,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 296
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   |        |                                                                      +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 297
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        |                 +------------------------------------COMP:N-N(from)------------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   |        |                 |                                                    +----------MOD_ATT:N-ADJ----------+     |       +-----------------------------SUBJ:V-N----------------------------+       |  +------------MOD_ATT:N-N-----------+     
                   |        |                 |         +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +----------------APPOS---------------+                   |       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                  |                   |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+                  |                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:N-N(from) (fragment,protein)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GATCCTGATCACGTGATCGAGGAG)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 298
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 299
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   |        |                                                                      +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       +-------COMP:N-N(of)-------+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (same,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 300
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 301
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       |                                                                 |       |  +------------MOD_ATT:N-N-----------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 302
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   |        |                                                                      +----------MOD_ATT:N-ADJ----------+     |       +-----------------------------SUBJ:V-N----------------------------+       |  +------------MOD_ATT:N-N-----------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +----------------APPOS---------------+                   |       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                  |                   |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+                  |                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GATCCTGATCACGTGATCGAGGAG)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 303
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       +-----------------------------SUBJ:V-N----------------------------+       |  +------------MOD_ATT:N-N-----------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +----------------APPOS---------------+                   |       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                  |                   |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+                  |                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GATCCTGATCACGTGATCGAGGAG)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 304
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                 +-------------------OBJ:V-N-------------------+     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                 |       +-------------MOD_ATT:N-N-------------+     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       +-----------------------------SUBJ:V-N----------------------------+       |  +------------MOD_ATT:N-N-----------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +----------------APPOS---------------+                   |       |  |     +---------MOD_ATT:N-N--------+     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                  |                   |       |  |     |            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+                  |                   |       |  |     |            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GATCCTGATCACGTGATCGAGGAG)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,protein)
MOD_ATT:N-N (protein,E)
MOD_ATT:N-N (protein,box)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 305
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   |        |                                                        |             +----------MOD_ATT:N-ADJ----------+     |       +--------------------------------------------------COMP:N-N(as)-------------------------------------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 306
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     |       +--------------------------------------------------COMP:N-N(as)-------------------------------------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(as) (same,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 307
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     |       +--------------------------------------------------COMP:N-N(as)-------------------------------------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 308
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                 +------------------------------------COMP:N-N(from)------------------------------------+     |       |                                                                                                                     
                   |        |                 |                                                    +----------MOD_ATT:N-ADJ----------+     |       +--------------------------------------------------COMP:N-N(as)-------------------------------------------------+     
                   |        |                 |         +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:N-N(from) (fragment,protein)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(as) (same,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 309
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                                                                             
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |                                                                                                                             
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     |           +--------------------------------------------------OBJ:V-N--------------------------------------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |           |    +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |           |    +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +-MOD:V-ADV-+OBJ:+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |           |    |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
MOD:V-ADV (be,as)
OBJ:V-N (as,bind)
OBJ:V-N (as,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 310
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                                                                             
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |                                                                                                                             
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     +------------------------------------------------------COMP:V-N(as)-----------------------------------------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |                +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |                +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |                |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |                |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
COMP:V-N(as) (be,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 311
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     +------------------------------------------------------COMP:V-N(as)-----------------------------------------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,bind)
COMP:V-N(as) (be,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 312
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   |        |                           |                                          +----------MOD_ATT:N-ADJ----------+     +------------------------------------------------------COMP:V-N(as)-----------------------------------------------------+     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,bind)
COMP:V-N(as) (be,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 313
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                                                                             
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |                                                                                                                             
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |           +--------------------------------------------------OBJ:V-N--------------------------------------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |           |    +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |           |    +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +-MOD:V-ADV-+OBJ:+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |           |    |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
MOD:V-ADV (be,as)
OBJ:V-N (as,bind)
OBJ:V-N (as,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 314
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +---------------------------------------------------SUBJ:V-N---------------------------------------------------+                                                                                                                             
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |                                                                                                                             
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     +------------------------------------------------------COMP:V-N(as)-----------------------------------------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |                +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |                +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |                |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |                |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
SUBJ:V-N (be,bind)
COMP:V-N(as) (be,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 315
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     +------------------------------------------------------COMP:V-N(as)-----------------------------------------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,bind)
COMP:V-N(as) (be,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 316
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        |                           +-------------------------------COMP:V-N(from)-------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     +------------------------------------------------------COMP:V-N(as)-----------------------------------------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     +--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
COMP:V-N(from) (contain,protein)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:V-N(as) (be,bind)
COMP:V-N(as) (be,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 317
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                             
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                                     
                   |        +---------------------------------------------COMP:N-N(from)---------------------------------------------+     |       |                                                                                                                     
                   +------------COMP:V-N(In)------------+                                          +----------MOD_ATT:N-ADJ----------+     |       +--------------------------------------------------COMP:N-N(as)-------------------------------------------------+     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
COMP:N-N(from) (bind,protein)
MOD_PRED:N-N (bind,same)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 318
                            +-------------------------------------------------------------------------------------------------------------MOD_PRED:N-N-------------------------------------------------------------------------------------------------------------+     
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                       |     
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                               |     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                               |     
                   |        |                                                        |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                                                               |     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_PRED:N-N (bind,protein)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 319
                            +-------------------------------------------------------------------------------------------------------------MOD_PRED:N-N-------------------------------------------------------------------------------------------------------------+     
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                       |     
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                               |     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                               |     
                   |        |                                                        |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                                                               |     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_PRED:N-N (bind,protein)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 320
                            +-------------------------------------------------------------------------------------------------------------MOD_PRED:N-N-------------------------------------------------------------------------------------------------------------+     
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                       |     
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                               |     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                               |     
                   |        |                                                        |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                                                               |     
                   |        |                           +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       +-----------------------------SUBJ:V-N----------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       +-------COMP:N-N(of)-------+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_PRED:N-N (bind,protein)
MOD_ATT:N-N (fragment,DNA)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (same,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,same)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 321
                            +-------------------------------------------------------------------------------------------------------------MOD_PRED:N-N-------------------------------------------------------------------------------------------------------------+     
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                       |     
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                               |     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                               |     
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                                                               |     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_PRED:N-N (bind,protein)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(as) (same,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 322
                            +-------------------------------------------------------------------------------------------------------------MOD_PRED:N-N-------------------------------------------------------------------------------------------------------------+     
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                       |     
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                               |     
                   |        |                                                        +-----------------COMP:N-N(from)----------------+     |       |                                                                                                               |     
                   +------------COMP:V-N(In)------------+                            |             +----------MOD_ATT:N-ADJ----------+     |       |                                                                                                               |     
                   |        +----------SUBJ:V-N---------+-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+         |           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       |        |          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_PRED:N-N (bind,protein)
MOD_ATT:N-N (fragment,DNA)
COMP:V-N(In) (contain,system)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
COMP:N-N(from) (element,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In) (be,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCCTGATCACGTGATCGAGGAG)
SUBJ:V-N (contain,bind)
OBJ:V-N (contain,element)
MOD_ATT:N-N (element,E)
MOD_ATT:N-N (element,box)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])

Analyse 323
                            +-------------------------------------------------------------------------------------------------------------MOD_PRED:N-N-------------------------------------------------------------------------------------------------------------+     
                   +------------------------------------------------------COMP:V-N(In)-----------------------------------------------------+                                                                                                                       |     
                   |        +-----------------------------------------------------MOD_PRED:N-N-----------------------------------------------------+                                                                                                               |     
                   |        |                 +------------------------------------COMP:N-N(from)------------------------------------+     |       |                                                                                                               |     
                   |        |                 |                                                    +----------MOD_ATT:N-ADJ----------+     |       |                                                                                                               |     
                   |        |                 |         +-----------OBJ:V-N----------+             |      +--------MOD_ATT:N-N-------+     |       |        +------------------------SUBJ:V-N------------------------+-----OBJ:V-N----+                            |     
        +MOD_ATT:N-+        +---COMP:N-N(of)--+         |           +--MOD_ATT:N-ADJ-+             |      |          +--MOD_ATT:N-N--+     |       |        +---COMP:N-N(of)--+                                      |       +MOD_ATT:+            +--MOD_ATT:N-N--+     
        |    +MOD_A+        |          +MOD_AT+-SUBJ:V-N+           |        +MOD_ATT+             |      |          |      +MOD_ATT:+     |       +COMP:N-N+          +MOD_AT+-------APPOS------+                   |       |  +MOD_A+            |      +MOD_ATT:+     
        |    |     |        |          |      |         |           |        |       |             |      |          |      |        |     |       |        |          |      |                  |                   |       |  |     |            |      |        |     
 In a cell free system , binding of a DNA fragment containing a __NODE__ response element from __NODE__ gene and ADD 1 [__NODE__] protein is the same as binding of a DNA fragment ( GATCCTGATCACGTGATCGAGGAG ) containing a E box element and ADD 1 [__NODE__] protein .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
COMP:N-N(of) (bind,fragment)
MOD_PRED:N-N (bind,same)
MOD_PRED:N-N (bind,protein)
MOD_ATT:N-N (fragment,DNA)
COMP:N-N(from) (fragment,protein)
SUBJ:V-N (contain,fragment)
OBJ:V-N (contain,element)
MOD_ATT:N-ADJ (element,__NODE__)
MOD_ATT:N-N (element,response)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,1)
MOD_ATT:N-N (protein,[__NODE__])
COMP:V-N(In)