Validation pour Ingenuity177

vers la météo de la validation par utilisateur

Ingenuity177

precedent - 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 - suivant

Phrase 79 - PMID ?

In a cell free system , binding of promoter fragment ( CATTCTGGGTCAAAGTTGATCCCCT ) from NODE gene(s) consisting of DR1 response element and a protein protein complex consisting of frog NODE and of SP NODE is greater than binding of promoter fragment ( CATTCTGGGTCAAAGTTGATCCCCT ) from mutant NODE gene(s) ( C?T A?C T?G C?A T?G ) consisting of DR1 response element and a protein protein complex consisting of frog NODE and of SP NODE .

Non annotée
Je ne sais pas
Je n'ai pas trouvé d'analyse satisfaisante

Commentaires :

Analyse 0

                                                                                                                                +------------------MOD_ATT:N-N------------------+                                                                                                                                                                                                                                                                                                  
                                                                                                                                |                     +-------MOD_ATT:N-N-------+----------------SUBJ:V-N----------------+          +----------MOD_ATT:N-ADJ----------+                                          +---------MOD_ATT:N-ADJ---------+                           +----------------------MOD_ATT:N-N---------------------+                                              
             +----OBJ:V-N---+--------------COMP:N-N(of)-------------+--------------------COMP:N-N(of)--------------------+      |                     |       +---MOD_ATT:N-N---+---COMP:N-N(of)--+                      |          |            +----MOD_ATT:N-ADJ---+                                          |       +-----MOD_ATT:N-ADJ-----+                           |                                    +---MOD_ATT:N-N---+----------------SUBJ:V-N----------------+     
             |     +MOD_ATT:+                    +----MOD_ATT:N-N---+                        +MOD_ATT+                   |      |                     |       |       +MOD_ATT:N+          +MOD_AT+              +SUBJ:V-+          |            |           +MOD_ATT:+----MOD_ATT:N-N---+                       |       |       +---APPOS---+   |                           |                                    |       +MOD_ATT:N+---COMP:N-N(of)--+              +SUBJ:V-+     
             |     |        |                    |                  |                        |       |                   |      |                     |       |       |         |          |      |              |       |          |            |           |        |                  |                       |       |       |           |   |                           |                                    |       |         |                 |              |       |     
 In a cell free system , binding of promoter fragment ( CATTCTGGGTCAAAGTTGATCCCCT ) from __NODE__ gene(s) consisting of DR1 response element and a protein protein complex consisting of frog __NODE__ and of __SP__ __NODE__ is greater than binding of promoter fragment ( CATTCTGGGTCAAAGTTGATCCCCT ) from mutant __NODE__ gene(s) ( C?T A?C T?G C?A T?G ) consisting of DR1 response element and a protein protein complex consisting of frog __NODE__ and of __SP__ __NODE__ .
OBJ:V-N (free,bind)
MOD_ATT:N-N (bind,system)
COMP:N-N(of) (bind,CATTCTGGGTCAAAGTTGATCCCCT)
MOD_ATT:N-N (CATTCTGGGTCAAAGTTGATCCCCT,fragment)
COMP:N-N(of) (CATTCTGGGTCAAAGTTGATCCCCT,DR1)
MOD_ATT:N-ADJ (gene(s),__NODE__)
MOD_ATT:N-N (consist,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (__NODE__,frog)
SUBJ:V-N (__NODE__,consist)
SUBJ:V-N (__NODE__,__SP__)
MOD_ATT:N-ADJ (fragment,great)
MOD_ATT:N-ADJ (fragment,bind)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (CATTCTGGGTCAAAGTTGATCCCCT,fragment)
APPOS (gene(s),A?C)
MOD_ATT:N-ADJ (T?G,mutant)
MOD_ATT:N-ADJ (T?G,__NODE__)
MOD_ATT:N-N (consist,DR1)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
SUBJ:V-N (__NODE__,consist)
SUBJ:V-N (__NODE__,__SP__)