In a cell free system , binding of promoter fragment ( GCGGACCAGGACAAAGGTCACGTTC ) from __NODE__ gene(s) consisting of __NODE__ response element and mutant __SP__ __NODE__ protein ( C terminal truncation 250 End with its DNA binding domain retained ) is greater than binding of promoter fragment ( GCGGACCAGGACAAAGGTCACGTTC ) from __NODE__ gene(s) consisting of __NODE__ response element and mutant __SP__ __NODE__ protein ( C terminal truncation 225 End with its DNA binding domain retained ) .