In a cell free system , the affinity of binding of promoter fragment ( GATCAGGACGTTGGGGTTAGGGGAGGACAGATC ) from __NODE__ gene(s) consisting of __NODE__ response element and a protein protein complex consisting of __SP__ __NODE__ and of __SP__ __NODE__ is greater than the affinity of binding of promoter fragment ( GATCAGGACGTTGGGGTTAGGGGAGGACAGATC ) from __NODE__ gene(s) consisting of __NODE__ response element and a protein protein complex consisting of mutant __SP__ __NODE__ ( A?F V?E Q?G with its T box domain mutated ) and of __SP__ __NODE__ .