vers la météo de la validation par utilisateur

Ingenuity181


precedent - 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 - suivant

Phrase 36 - PMID ?

In a cell free system , the affinity of binding of promoter fragment ( GATCAGGACGTTGGGGTTAGGGGAGGACAGATC ) from __NODE__ gene(s) consisting of __NODE__ response element and a protein protein complex consisting of __SP__ __NODE__ and of __SP__ __NODE__ is greater than the affinity of binding of promoter fragment ( GATCAGGACGTTGGGGTTAGGGGAGGACAGATC ) from __NODE__ gene(s) consisting of __NODE__ response element and a protein protein complex consisting of mutant __SP__ __NODE__ ( A?F V?E Q?G with its T box domain mutated ) and of __SP__ __NODE__ .


Non annotée
Je ne sais pas
Je n'ai pas trouvé d'analyse satisfaisante


Commentaires :

Analyse 0
                                                                                                                             +----------------------------------MOD_ATT:N-N----------------------------------+                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                             |                                                     +-------MOD_ATT:N-N-------+                                                                                                                                                                                                                                                                                                                                                         
             +------------OBJ:V-N-----------+                                                                                |                                                     |       +---MOD_ATT:N-N---+-----------------SUBJ:V-N-----------------+                                       +----MOD_ATT:N-ADJ---+                                                                                           +---------MOD_ATT:N-N---------+       +--------MOD_ATT:N-ADJ-------+------MOD_ATT:N-N------+           +MOD_ATT:+----------COMP:N-N(of)---------+     
             |                   +MOD_ATT:N-+           +-------------------------MOD_ATT:N-N------------------------+       |                                                     |       |       +MOD_ATT:N+----COMP:N-N(of)---+              +SUBJ:V-+-----------OBJ:V-N----------+          |           +MOD_ATT:+------MOD_ATT:N-N-----+                            +MOD_ATT+         +-MOD_ATT:N-N+        |                     +MOD_ATT+       |                     +MOD_AT+       +-APPOS-+       |           |  +MOD_A+SUBJ:V+                +MOD_ATT+     
             |                   |          |           |                                                            |       |                                                     |       |       |         |                   |              |       |                            |          |           |        |                      |                            |       |         |            |        |                     |       |       |                     |      |       |       |       |           |  |     |      |                |       |     
 In a cell free system , the affinity of binding of promoter fragment ( GATCAGGACGTTGGGGTTAGGGGAGGACAGATC ) from __NODE__ gene(s) consisting of __NODE__ response element and a protein protein complex consisting of __SP__ __NODE__ and of __SP__ __NODE__ is greater than the affinity of binding of promoter fragment ( GATCAGGACGTTGGGGTTAGGGGAGGACAGATC ) from __NODE__ gene(s) consisting of __NODE__ response element and a protein protein complex consisting of mutant __SP__ __NODE__ ( A?F V?E Q?G with its T box domain mutated ) and of __SP__ __NODE__ .
OBJ:V-N (free,bind)
MOD_ATT:N-N (bind,affinity)
MOD_ATT:N-N (__NODE__,promoter)
MOD_ATT:N-N (consist,gene(s))
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
SUBJ:V-N (__NODE__,consist)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,affinity)
MOD_ATT:N-ADJ (fragment,bind)
MOD_ATT:N-N (fragment,promoter)
MOD_ATT:N-N (GATCAGGACGTTGGGGTTAGGGGAGGACAGATC,fragment)
MOD_ATT:N-ADJ (gene(s),__NODE__)
MOD_ATT:N-N (__NODE__,consist)
MOD_ATT:N-N (protein,response)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-ADJ (__SP__,complex)
MOD_ATT:N-ADJ (__SP__,mutant)
APPOS (__NODE__,A?F)
MOD_ATT:N-N (Q?G,__SP__)
MOD_ATT:N-N (domain,T)
MOD_ATT:N-N (domain,box)
COMP:N-N(of) (domain,__NODE__)
SUBJ:V_PASS-N (mutate,domain)
MOD_ATT:N-ADJ (__NODE__,__SP__)

Analyse 1
                                                                                                                             +---------------------------------------------------COMP:N-N(of)---------------------------------------------------+                                                                                                                                                                                                                                                                                                                      
                                                                                                                             +--------------------------------------------COMP:N-N(of)-------------------------------------------+              |                                                                                                                                                                                                                                                                                                                      
                                                                                                                             |                                                     +------------------------COMP:N-N(of)------------------------+                                                                                                                                +------------------------------------SUBJ:V-N-----------------------------------+                  +---------------COMP:N-N(with)---------------+                                     
                                                                                                                             |                                                     +-----------------COMP:N-N(of)----------------+              |                                                                                                                                |                                                     +--MOD_ATT:N-N--+         +---COMP:N-N(of)---+                                   +MOD_ATT:+                                     
             +------------OBJ:V-N-----------+----------------COMP:N-N(of)---------------+                                    |                                                     |                                     +MOD_ATT+              |       +SUBJ:+                                             +----------MOD_ATT:N-N----------+                            +MOD_ATT+         +-MOD_ATT:N-N+                              |       +MOD_ATT+-SUBJ:V-N+           +MOD_AT+       +--MOD_ATT:N-N--+           |  +MOD_A+      +--MOD_ATT:N-ADJ-+             
             |                              |                                           |                                    |                                                     |                                     |       |              |       |     |                                             |                               |                            |       |         |            |                              |       |       |         |           |      |       |               |           |  |     |      |                |             
 In a cell free system , the affinity of binding of promoter fragment ( GATCAGGACGTTGGGGTTAGGGGAGGACAGATC ) from __NODE__ gene(s) consisting of __NODE__ response element and a protein protein complex consisting of __SP__ __NODE__ and of __SP__ __NODE__ is greater than the affinity of binding of promoter fragment ( GATCAGGACGTTGGGGTTAGGGGAGGACAGATC ) from __NODE__ gene(s) consisting of __NODE__ response element and a protein protein complex consisting of mutant __SP__ __NODE__ ( A?F V?E Q?G with its T box domain mutated ) and of __SP__ __NODE__ .
OBJ:V-N (free,bind)
COMP:N-N(of) (bind,GATCAGGACGTTGGGGTTAGGGGAGGACAGATC)
COMP:N-N(of) (gene(s),__NODE__)
COMP:N-N(of) (gene(s),__SP__)
COMP:N-N(of) (protein,__NODE__)
COMP:N-N(of) (protein,__SP__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
SUBJ:V-N (be,__NODE__)
MOD_ATT:N-N (GATCAGGACGTTGGGGTTAGGGGAGGACAGATC,promoter)
MOD_ATT:N-ADJ (gene(s),__NODE__)
MOD_ATT:N-N (__NODE__,consist)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,gene(s))
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__SP__)
MOD_ATT:N-ADJ (__SP__,mutant)
COMP:N-N(with) (__SP__,domain)
MOD_ATT:N-N (Q?G,__NODE__)
MOD_ATT:N-N (domain,T)
MOD_ATT:N-N (domain,box)
MOD_ATT:N-ADJ (__SP__,mutate)