vers la météo de la validation par utilisateur

Ingenuity181


precedent - 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 - suivant

Phrase 70 - PMID ?

In a cell free system , the efficiency of binding of a DNA fragment ( TCGAGGGTAGGGGTCAGAGGTCACTCG ) and a protein RNA complex consisting of __SP__ __NODE__ and of __SP__ __NODE__ is greater than the efficiency of binding of promoter fragment ( 82 61 ) from __SP__ __NODE__ gene and a protein RNA complex consisting of __SP__ __NODE__ and of __SP__ __NODE__ .


Non annotée
Je ne sais pas
Je n'ai pas trouvé d'analyse satisfaisante


Commentaires :

Analyse 0
             +-------------OBJ:V-N------------+                                                                                                                                                                                                       +--------OBJ:V-N-------+      +-----------MOD_ATT:N-N-----------+-----------------SUBJ:V-N-----------------+     
             |     +--------MOD_ATT:N-N-------+          +------------------------APPOS-----------------------+     +-------------------------SUBJ:V-N-------------------------+     +--------------SUBJ:V-N-------------+                            |  +------SUBJ:V-N-----+      |                 +--MOD_ATT:N-N--+----COMP:N-N(of)---+                      |     
             |     |              +MOD_ATT:N-N+COMP:N-N(o+-----------APPOS----------+                         |     |                                                  +SUBJ:V-+     |                       +MOD_ATT:N-N+--------COMP:N-N(of)--------+  +COMP:N-N(fr+       |      |                 |     +MOD_ATT:N+           +MOD_ATT+              +SUBJ:V-+     
             |     |              |           |          |                          |                         |     |                                                  |       |     |                       |           |                            |  |           |       |      |                 |     |         |           |       |              |       |     
 In a cell free system , the efficiency of binding of a DNA fragment ( TCGAGGGTAGGGGTCAGAGGTCACTCG ) and a protein RNA complex consisting of __SP__ __NODE__ and of __SP__ __NODE__ is greater than the efficiency of binding of promoter fragment ( 82 61 ) from __SP__ __NODE__ gene and a protein RNA complex consisting of __SP__ __NODE__ and of __SP__ __NODE__ .
OBJ:V-N (free,bind)
MOD_ATT:N-N (bind,system)
MOD_ATT:N-N (bind,efficiency)
COMP:N-N(of) (bind,DNA)
APPOS (DNA,TCGAGGGTAGGGGTCAGAGGTCACTCG)
APPOS (DNA,protein)
SUBJ:V-N (__NODE__,RNA)
SUBJ:V-N (__NODE__,__SP__)
SUBJ:V-N (be,bind)
MOD_ATT:N-N (bind,efficiency)
COMP:N-N(of) (bind,@card@)
COMP:N-N(from) (@card@,__SP__)
OBJ:V-N (__NODE__,@card@)
SUBJ:V-N (__NODE__,@card@)
MOD_ATT:N-N (consist,gene)
MOD_ATT:N-N (consist,RNA)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
SUBJ:V-N (__NODE__,consist)
SUBJ:V-N (__NODE__,__SP__)