In a cell free system , the efficiency of binding of a DNA fragment ( TCGAGGGTAGGGGTCAGAGGTCACTCG ) and a protein RNA complex consisting of __SP__ __NODE__ and of __SP__ __NODE__ is greater than the efficiency of binding of promoter fragment ( 643 598 ) from __SP__ __NODE__ gene consisting of __NODE__ response element and a protein RNA complex consisting of __SP__ __NODE__ and of __SP__ __NODE__ .