vers la météo de la validation par utilisateur

Ingenuity181


precedent - 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 - suivant

Phrase 65 - PMID ?

In a cell free system , the efficiency of binding of a DNA fragment ( TCGAGGGTAGGGGTCAGAGGTCACTCG ) and a protein protein complex consisting of __SP__ __NODE__ and of __SP__ __NODE__ is greater than the efficiency of binding of promoter fragment ( 59 33 ) from __SP__ __NODE__ gene consisting of __NODE__ response element and a protein protein complex consisting of __SP__ __NODE__ and of __SP__ __NODE__ .


Non annotée
Je ne sais pas
Je n'ai pas trouvé d'analyse satisfaisante


Commentaires :

Analyse 0
             +-------------OBJ:V-N------------+                                                                               +--------------------------OBJ:V-N-------------------------+                                                                +-------SUBJ:V-N-------+                                    +------------------MOD_ATT:N-N------------------+                                                
             |     +--------MOD_ATT:N-N-------+----------------APPOS----------------+                                         |         +----COMP:N-N(of)---+              +---OBJ:V-N---+                                                                +----OBJ:V-N---+       |                                    |                             +---MOD_ATT:N-N---+-----------------SUBJ:V-N-----------------+     
             |     |              +MOD_ATT:N-N+          +MOD_AT+                   |                         +MOD_ATT+       |         |           +MOD_ATT+              |       +SUBJ:+                                                                |  +--SUBJ:V-N-+       +----------OBJ:V-N----------+        |                             |       +MOD_ATT:N+COMP:N-N(of+                      +SUBJ:V-+     
             |     |              |           |          |      |                   |                         |       |       |         |           |       |              |       |     |                                                                |  |           |       |                           |        |                             |       |         |           |                      |       |     
 In a cell free system , the efficiency of binding of a DNA fragment ( TCGAGGGTAGGGGTCAGAGGTCACTCG ) and a protein protein complex consisting of __SP__ __NODE__ and of __SP__ __NODE__ is greater than the efficiency of binding of promoter fragment ( 59 33 ) from __SP__ __NODE__ gene consisting of __NODE__ response element and a protein protein complex consisting of __SP__ __NODE__ and of __SP__ __NODE__ .
OBJ:V-N (free,bind)
MOD_ATT:N-N (bind,system)
MOD_ATT:N-N (bind,efficiency)
APPOS (bind,TCGAGGGTAGGGGTCAGAGGTCACTCG)
MOD_ATT:N-N (fragment,DNA)
MOD_ATT:N-N (protein,protein)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (be,complex)
OBJ:V-N (be,__SP__)
SUBJ:V-N (be,__NODE__)
OBJ:V-N (__SP__,@card@)
SUBJ:V-N (__SP__,@card@)
SUBJ:V-N (__NODE__,@card@)
OBJ:V-N (__NODE__,__NODE__)
MOD_ATT:N-N (consist,response)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__SP__)
SUBJ:V-N (__NODE__,consist)
SUBJ:V-N (__NODE__,__SP__)