vers la météo de la validation par utilisateur

Ingenuity181

precedent - 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 - suivant

Phrase 62 - PMID ?

In a cell free system , the efficiency of binding of a DNA fragment ( TCGAGGGTAGGGGTCAGAGGTCACTCG ) and a protein protein complex consisting of __SP__ __NODE__ and of __SP__ __NODE__ is greater than or equal to the efficiency of binding of promoter fragment ( 643 598 ) from __SP__ __NODE__ gene consisting of __NODE__ response element and a protein protein complex consisting of __SP__ __NODE__ and of __SP__ __NODE__ .


Non annotée
Je ne sais pas
Je n'ai pas trouvé d'analyse satisfaisante


Commentaires :
Analyse 0 
                                                                                                                                                                                                                                                                          +--------------SUBJ:V-N-------------+                                                                                                                      
                                                         +------------------------APPOS-----------------------+                                                            +---OBJ:V-N---+                                                                                +---COMP:N-N(from)---+              |                             +-----MOD_ATT:N-N-----+                 +-----------------SUBJ:V-N-----------------+     
                   +--MOD_ATT:N-N-+           +--OBJ:V-N-+-----------APPOS----------+                         |                                                            |       +SUBJ:+                                               +-------------OBJ:V-N------------+            +MOD_ATT+              +COMP:N-N(of)+                |             +MOD_ATT+       +MOD_ATT:N+           +MOD_ATT+              +SUBJ:V-+     
                   |              |           |          |                          |                         |                                                            |       |     |                                               |                                |            |       |              |            |                |             |       |       |         |           |       |              |       |     
 In a cell free system , the efficiency of binding of a DNA fragment ( TCGAGGGTAGGGGTCAGAGGTCACTCG ) and a protein protein complex consisting of __SP__ __NODE__ and of __SP__ __NODE__ is greater than or equal to the efficiency of binding of promoter fragment ( 643 598 ) from __SP__ __NODE__ gene consisting of __NODE__ response element and a protein protein complex consisting of __SP__ __NODE__ and of __SP__ __NODE__ .
MOD_ATT:N-N (efficiency,system)
OBJ:V-N (bind,DNA)
APPOS (DNA,TCGAGGGTAGGGGTCAGAGGTCACTCG)
APPOS (DNA,protein)
OBJ:V-N (be,__SP__)
SUBJ:V-N (be,__NODE__)
OBJ:V-N (bind,@card@)
COMP:N-N(from) (@card@,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
SUBJ:V-N (consist,@card@)
COMP:N-N(of) (consist,__NODE__)
MOD_ATT:N-N (protein,element)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-N (consist,complex)
MOD_ATT:N-ADJ (__NODE__,__SP__)
SUBJ:V-N (__NODE__,consist)
SUBJ:V-N (__NODE__,__SP__)