vers la météo de la validation par utilisateur

Ingenuity187

precedent - 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 - suivant

Phrase 25 - PMID ?

In a system of purified components , binding of a DNA fragment ( 145 121 ) ( 5 ' GCGAGGGCGGGCGCAAGGGCGGCCA 3 ' containing a __NODE__ binding site 1 2 from __SP__ __NODE__ gene and a protein protein complex consisting of __SP__ __NODE__ and of __SP__ __NODE__ and of __SP__ __NODE__ is greater than or equal to binding of a DNA fragment ( 154 130 ) ( 5 ' ATCCCATGCGCGAGGGCGGGCGCAA 3 ' containing a __NODE__ binding site 2 from __SP__ __NODE__ gene and a protein protein complex consisting of __SP__ __NODE__ and of __SP__ __NODE__ and of __SP__ __NODE__ .


Non annotée
Je ne sais pas
Je n'ai pas trouvé d'analyse satisfaisante


Commentaires :
Analyse 0 
                                                                                                                                                                                                                    +-----------------------COMP:N-N(of)----------------------+                                                                                                                                                                                                                                                                                            
                                                                                                                                                                                                                    +---------------COMP:N-N(of)---------------+              |                                                                                                                                                                       +---------------------------------------------COMP:N-N(of)---------------------------------------------+             
                              +----------SUBJ:V-N----------+           +---------APPOS--------+                                  +-----------OBJ:V-N-----------+       +------------------SUBJ:V-N------------------+                                  +-----MOD_ATT:N-ADJ----+                                                                         +----------------APPOS---------------+                                                        |                                  +----------------------------COMP:N-N(of)---------------------------+             
                    +MOD_ATT:N+-SUBJ:V-N-+                 |           |      +-MOD_ATT:N-ADJ-+             +SUBJ:V-N+--OBJ:V-N--+SUBJ:V-+         +--SUBJ:V-N-+       |                  +---------SUBJ:V-N--------+----COMP:N-N(of)---+              +MOD_ATT+              |       +SUBJ:+           +------------------COMP:N-N(of)-----------------+      +-MOD_ATT:N-ADJ-+             |        +--OBJ:V-N--+                           +MOD_ATT+                          +MOD_ATT+                                            +-----COMP:N-N(of)-----+             
                    |         |          |                 |           |      |               |             |        |           |       |         |           |       |                  |                         |                   |              |       |              |       |     |           |                                               |      |               |             |        |           |                           |       |                          |       |                                            |                      |             
 In a system of purified components , binding of a DNA fragment ( 145 121 ) ( 5 ' GCGAGGGCGGGCGCAAGGGCGGCCA 3 ' containing a __NODE__ binding site 1 2 from __SP__ __NODE__ gene and a protein protein complex consisting of __SP__ __NODE__ and of __SP__ __NODE__ and of __SP__ __NODE__ is greater than or equal to binding of a DNA fragment ( 154 130 ) ( 5 ' ATCCCATGCGCGAGGGCGGGCGCAA 3 ' containing a __NODE__ binding site 2 from __SP__ __NODE__ gene and a protein protein complex consisting of __SP__ __NODE__ and of __SP__ __NODE__ and of __SP__ __NODE__ .
MOD_ATT:N-ADJ (component,purify)
SUBJ:V-N (bind,component)
SUBJ:V-N (fragment,component)
APPOS (@card@,GCGAGGGCGGGCGCAAGGGCGGCCA)
MOD_ATT:N-ADJ (GCGAGGGCGGGCGCAAGGGCGGCCA,5)
SUBJ:V-N (contain,3)
OBJ:V-N (contain,__NODE__)
SUBJ:V-N (binding,__NODE__)
OBJ:V-N (__SP__,__NODE__)
SUBJ:V-N (__SP__,1)
SUBJ:V-N (consist,__NODE__)
SUBJ:V-N (consist,protein)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__SP__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (__SP__,__SP__)
SUBJ:V-N (be,__NODE__)
COMP:N-N(of) (than,@card@)
APPOS (@card@,3)
MOD_ATT:N-ADJ (ATCCCATGCGCGAGGGCGGGCGCAA,5)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
COMP:N-N(of) (__NODE__,__SP__)
MOD_ATT:N-N (complex,protein)
COMP:N-N(of) (complex,__SP__)
COMP:N-N(of) (__SP__,__SP__)