Validation pour Ingenuity187

vers la météo de la validation par utilisateur

Ingenuity187

precedent - 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 - suivant

Phrase 32 - PMID ?

In a system of purified components , binding of a DNA fragment ( GATCTGTGAACTCTGATCCAGTAAG ) from NODE response element and SP NODE protein and SP NODE protein is the same as binding of a DNA fragment ( GATCTGTGAACTCTGATCCAGTAAG ) from NODE response element and dominant negative mutant SP NODE protein ( C terminal truncation ) and SP NODE protein .

Non annotée
Je ne sais pas
Je n'ai pas trouvé d'analyse satisfaisante

Commentaires :

Analyse 0

                                                                                                                                                                                                                                                                     +----------------------------MOD_ATT:N-ADJ----------------------------+                                                           
                                                                                                                                                                                                                                                                     |                             +-------------MOD_ATT:N-ADJ-------------+                                                           
                                                                                                       +----------------MOD_ATT:N-ADJ---------------+                                                                                                                |                             |        +---------MOD_ATT:N-ADJ--------+                                                           
         +-------------------COMP:N-N(of)------------------+                                           |        +------------MOD_ATT:N-N------------+-------------OBJ:V-N-------------+                                                                              |                             |        |       +-----MOD_ATT:N-ADJ----+---------APPOS--------+                                    
         +----COMP:N-N(of)----+                            |                                           |        |       +----MOD_ATT:N-N----+       |                   +---OBJ:V-N---+           +-----COMP:N-N(of)-----+                                           |                             |        |       |      +-MOD_ATT:N-ADJ-+      +--MOD_ATT:N-N--+              +-MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+-SUBJ:V-N-+          +MOD_AT+-------APPOS------+                        |        |       |           +MOD_ATT+       |           +MOD_ATT+       +SUBJ:+-MOD:V-ADV-+OBJ:+          +MOD_AT+-------APPOS------+                        |                             |        |       |      |       +MOD_ATT+      |     +MOD_ATT:N+              |       +MOD_ATT+     
         |          |         |          |          |      |                  |                        |        |       |           |       |       |           |       |       |     |           |    |          |      |                  |                        |                             |        |       |      |       |       |      |     |         |              |       |       |     
 In a system of purified components , binding of a DNA fragment ( GATCTGTGAACTCTGATCCAGTAAG ) from __NODE__ response element and __SP__ __NODE__ protein and __SP__ __NODE__ protein is the same as binding of a DNA fragment ( GATCTGTGAACTCTGATCCAGTAAG ) from __NODE__ response element and dominant negative mutant __SP__ __NODE__ protein ( C terminal truncation ) and __SP__ __NODE__ protein .
COMP:N-N(of) (system,component)
COMP:N-N(of) (system,fragment)
MOD_ATT:N-ADJ (component,purify)
SUBJ:V-N (bind,component)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCTGTGAACTCTGATCCAGTAAG)
MOD_ATT:N-N (__NODE__,element)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,response)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (be,protein)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
MOD:V-ADV (be,as)
OBJ:V-N (as,bind)
COMP:N-N(of) (as,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCTGTGAACTCTGATCCAGTAAG)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-ADJ (protein,dominant)
MOD_ATT:N-ADJ (protein,negative)
MOD_ATT:N-ADJ (protein,mutant)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
APPOS (protein,truncation)
MOD_ATT:N-N (truncation,C)
MOD_ATT:N-N (truncation,terminal)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 1

                                                                                                                                                                                                                                                                     +----------------------------MOD_ATT:N-ADJ----------------------------+                                                           
                                                                                                                                                                                                                                                                     |                             +-------------MOD_ATT:N-ADJ-------------+                                                           
                                                                                                       +----------------MOD_ATT:N-ADJ---------------+                                                                                                                |                             |        +---------MOD_ATT:N-ADJ--------+                                                           
         +-------------------COMP:N-N(of)------------------+                                           |        +------------MOD_ATT:N-N------------+-------------OBJ:V-N-------------+                +----------------APPOS---------------+                        |                             |        |       +-----MOD_ATT:N-ADJ----+---------APPOS--------+                                    
         +----COMP:N-N(of)----+                            |                                           |        |       +----MOD_ATT:N-N----+       |           +-------OBJ:V-N-------+                +---COMP:N-N(of)--+                  |                        |                             |        |       |      +-MOD_ATT:N-ADJ-+      +--MOD_ATT:N-N--+              +-MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+-SUBJ:V-N-+          +MOD_AT+-------APPOS------+                        |        |       |           +MOD_ATT+       |           |       +MOD_ATT+SUBJ:+                |          +MOD_AT+                  |                        |                             |        |       |      |       +MOD_ATT+      |     +MOD_ATT:N+              |       +MOD_ATT+     
         |          |         |          |          |      |                  |                        |        |       |           |       |       |           |       |       |     |                |          |      |                  |                        |                             |        |       |      |       |       |      |     |         |              |       |       |     
 In a system of purified components , binding of a DNA fragment ( GATCTGTGAACTCTGATCCAGTAAG ) from __NODE__ response element and __SP__ __NODE__ protein and __SP__ __NODE__ protein is the same as binding of a DNA fragment ( GATCTGTGAACTCTGATCCAGTAAG ) from __NODE__ response element and dominant negative mutant __SP__ __NODE__ protein ( C terminal truncation ) and __SP__ __NODE__ protein .
COMP:N-N(of) (system,component)
COMP:N-N(of) (system,fragment)
MOD_ATT:N-ADJ (component,purify)
SUBJ:V-N (bind,component)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCTGTGAACTCTGATCCAGTAAG)
MOD_ATT:N-N (__NODE__,element)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (protein,response)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,protein)
OBJ:V-N (be,__SP__)
SUBJ:V-N (be,protein)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GATCTGTGAACTCTGATCCAGTAAG)
MOD_ATT:N-N (fragment,DNA)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-ADJ (protein,dominant)
MOD_ATT:N-ADJ (protein,negative)
MOD_ATT:N-ADJ (protein,mutant)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
APPOS (protein,truncation)
MOD_ATT:N-N (truncation,C)
MOD_ATT:N-ADJ (truncation,terminal)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 2

                                                                                                                                                                                                                                                                     +----------------------------MOD_ATT:N-ADJ----------------------------+                                                           
                                                                                                                                                                                                                                                                     |                             +-------------MOD_ATT:N-ADJ-------------+                                                           
                                                                                                       +----------------MOD_ATT:N-ADJ---------------+                                                                                                                |                             |        +---------MOD_ATT:N-ADJ--------+                                                           
         +-------------------COMP:N-N(of)------------------+                                           |        +--------MOD_ATT:N-N--------+       +-------------OBJ:V-N-------------+                +----------------APPOS---------------+                        |                             |        |       +-----MOD_ATT:N-ADJ----+---------APPOS--------+                                    
         +----COMP:N-N(of)----+                            |                                           |        |       +----MOD_ATT:N-N----+       |                   +---OBJ:V-N---+                +---COMP:N-N(of)--+                  |                        |                             |        |       |      +-MOD_ATT:N-ADJ-+      +--MOD_ATT:N-N--+              +-MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+-SUBJ:V-N-+          +MOD_AT+-------APPOS------+                        |        |       |           +MOD_ATT+       |           +MOD_ATT+       +SUBJ:+-MOD:V-ADV-+OBJ:+          +MOD_AT+                  |                        |                             |        |       |      |       +MOD_ATT+      |     +MOD_ATT:N+              |       +MOD_ATT+     
         |          |         |          |          |      |                  |                        |        |       |           |       |       |           |       |       |     |           |    |          |      |                  |                        |                             |        |       |      |       |       |      |     |         |              |       |       |     
 In a system of purified components , binding of a DNA fragment ( GATCTGTGAACTCTGATCCAGTAAG ) from __NODE__ response element and __SP__ __NODE__ protein and __SP__ __NODE__ protein is the same as binding of a DNA fragment ( GATCTGTGAACTCTGATCCAGTAAG ) from __NODE__ response element and dominant negative mutant __SP__ __NODE__ protein ( C terminal truncation ) and __SP__ __NODE__ protein .
COMP:N-N(of) (system,component)
COMP:N-N(of) (system,fragment)
MOD_ATT:N-ADJ (component,purify)
SUBJ:V-N (bind,component)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCTGTGAACTCTGATCCAGTAAG)
MOD_ATT:N-N (__NODE__,response)
MOD_ATT:N-N (__NODE__,element)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (be,protein)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
MOD:V-ADV (be,as)
OBJ:V-N (as,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GATCTGTGAACTCTGATCCAGTAAG)
MOD_ATT:N-N (fragment,DNA)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-ADJ (protein,dominant)
MOD_ATT:N-ADJ (protein,negative)
MOD_ATT:N-ADJ (protein,mutant)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
APPOS (protein,truncation)
MOD_ATT:N-N (truncation,C)
MOD_ATT:N-ADJ (truncation,terminal)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 3

                                                                                                                                                                                                                                                                     +----------------------------MOD_ATT:N-ADJ----------------------------+                                                           
                                                                                                                                                                                                                                                                     |                             +-------------MOD_ATT:N-ADJ-------------+                                                           
                                                                                                                                                                                                                                                                     |                             |        +---------MOD_ATT:N-ADJ--------+                                                           
         +-------------------COMP:N-N(of)------------------+                                                                                                                                                                                                         |                             |        |       +-----MOD_ATT:N-ADJ----+---------APPOS--------+                                    
         +----COMP:N-N(of)----+                            |                                           +--------------SUBJ:V-N--------------+----------OBJ:V-N----------+---OBJ:V-N---+                +---COMP:N-N(of)--+                                           |                             |        |       |      +-MOD_ATT:N-ADJ-+      +--MOD_ATT:N-N--+              +-MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+-SUBJ:V-N-+          +MOD_AT+-------APPOS------+                        |                            +SUBJ:V-+OBJ:V-N+           +MOD_ATT+       +SUBJ:+                |          +MOD_AT+-------APPOS------+                        |                             |        |       |      |       +MOD_ATT+      |     +MOD_ATT:N+              |       +MOD_ATT+     
         |          |         |          |          |      |                  |                        |                            |       |       |           |       |       |     |                |          |      |                  |                        |                             |        |       |      |       |       |      |     |         |              |       |       |     
 In a system of purified components , binding of a DNA fragment ( GATCTGTGAACTCTGATCCAGTAAG ) from __NODE__ response element and __SP__ __NODE__ protein and __SP__ __NODE__ protein is the same as binding of a DNA fragment ( GATCTGTGAACTCTGATCCAGTAAG ) from __NODE__ response element and dominant negative mutant __SP__ __NODE__ protein ( C terminal truncation ) and __SP__ __NODE__ protein .
COMP:N-N(of) (system,component)
COMP:N-N(of) (system,fragment)
MOD_ATT:N-ADJ (component,purify)
SUBJ:V-N (bind,component)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCTGTGAACTCTGATCCAGTAAG)
SUBJ:V-N (__NODE__,__NODE__)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)
OBJ:V-N (__NODE__,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCTGTGAACTCTGATCCAGTAAG)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-ADJ (protein,dominant)
MOD_ATT:N-ADJ (protein,negative)
MOD_ATT:N-ADJ (protein,mutant)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
APPOS (protein,truncation)
MOD_ATT:N-N (truncation,C)
MOD_ATT:N-N (truncation,terminal)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 4

                                                                                                                                                                                                                                                                     +----------------------------MOD_ATT:N-ADJ----------------------------+                                                           
                                                                                                                                                                                                                                                                     |                             +-------------MOD_ATT:N-ADJ-------------+                                                           
                                                                                                                                                                                                                                                                     |                             |        +---------MOD_ATT:N-ADJ--------+                                                           
         +-------------------COMP:N-N(of)------------------+                                                                                        +-------------OBJ:V-N-------------+                +----------------APPOS---------------+                        |                             |        |       +-----MOD_ATT:N-ADJ----+---------APPOS--------+                                    
         +----COMP:N-N(of)----+                            |                                           +--------------SUBJ:V-N--------------+----------OBJ:V-N----------+---OBJ:V-N---+                +---COMP:N-N(of)--+                  |                        |                             |        |       |      +-MOD_ATT:N-ADJ-+      +--MOD_ATT:N-N--+              +-MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+-SUBJ:V-N-+          +MOD_AT+-------APPOS------+                        |                            +SUBJ:V-+OBJ:V-N+           +MOD_ATT+       +SUBJ:+                |          +MOD_AT+                  |                        |                             |        |       |      |       +MOD_ATT+      |     +MOD_ATT:N+              |       +MOD_ATT+     
         |          |         |          |          |      |                  |                        |                            |       |       |           |       |       |     |                |          |      |                  |                        |                             |        |       |      |       |       |      |     |         |              |       |       |     
 In a system of purified components , binding of a DNA fragment ( GATCTGTGAACTCTGATCCAGTAAG ) from __NODE__ response element and __SP__ __NODE__ protein and __SP__ __NODE__ protein is the same as binding of a DNA fragment ( GATCTGTGAACTCTGATCCAGTAAG ) from __NODE__ response element and dominant negative mutant __SP__ __NODE__ protein ( C terminal truncation ) and __SP__ __NODE__ protein .
COMP:N-N(of) (system,component)
COMP:N-N(of) (system,fragment)
MOD_ATT:N-ADJ (component,purify)
SUBJ:V-N (bind,component)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCTGTGAACTCTGATCCAGTAAG)
SUBJ:V-N (__NODE__,__NODE__)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)
OBJ:V-N (__NODE__,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (be,protein)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GATCTGTGAACTCTGATCCAGTAAG)
MOD_ATT:N-N (fragment,DNA)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-ADJ (protein,dominant)
MOD_ATT:N-ADJ (protein,negative)
MOD_ATT:N-ADJ (protein,mutant)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
APPOS (protein,truncation)
MOD_ATT:N-N (truncation,C)
MOD_ATT:N-ADJ (truncation,terminal)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 5

                                                                                                                                                                                                                                                                     +----------------------------MOD_ATT:N-ADJ----------------------------+                                                           
                                                                                                                                                                                                                                                                     |                             +-------------MOD_ATT:N-ADJ-------------+                                                           
                                                                                                       +------------------------SUBJ:V-N------------------------+                                                                                                    |                             |        +---------MOD_ATT:N-ADJ--------+                                                           
         +-------------------COMP:N-N(of)------------------+                                           +--------------SUBJ:V-N--------------+                   +------------MOD:V-ADV------------+                                                                  |                             |        |       +-----MOD_ATT:N-ADJ----+---------APPOS--------+                                    
         +----COMP:N-N(of)----+                            |                                           |                            +----------SUBJ:V-N---------+       +---OBJ:V-N---+           |    +---COMP:N-N(of)--+                                           |                             |        |       |      +-MOD_ATT:N-ADJ-+      +--MOD_ATT:N-N--+              +-MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+-SUBJ:V-N-+          +MOD_AT+-------APPOS------+                        |                            +SUBJ:V-+OBJ:V-N+           +OBJ:V-N+       +SUBJ:+           +OBJ:+          +MOD_AT+-------APPOS------+                        |                             |        |       |      |       +MOD_ATT+      |     +MOD_ATT:N+              |       +MOD_ATT+     
         |          |         |          |          |      |                  |                        |                            |       |       |           |       |       |     |           |    |          |      |                  |                        |                             |        |       |      |       |       |      |     |         |              |       |       |     
 In a system of purified components , binding of a DNA fragment ( GATCTGTGAACTCTGATCCAGTAAG ) from __NODE__ response element and __SP__ __NODE__ protein and __SP__ __NODE__ protein is the same as binding of a DNA fragment ( GATCTGTGAACTCTGATCCAGTAAG ) from __NODE__ response element and dominant negative mutant __SP__ __NODE__ protein ( C terminal truncation ) and __SP__ __NODE__ protein .
COMP:N-N(of) (system,component)
COMP:N-N(of) (system,fragment)
MOD_ATT:N-ADJ (component,purify)
SUBJ:V-N (bind,component)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCTGTGAACTCTGATCCAGTAAG)
SUBJ:V-N (__NODE__,__NODE__)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)
SUBJ:V-N (__SP__,__NODE__)
SUBJ:V-N (__SP__,__SP__)
OBJ:V-N (__SP__,__NODE__)
MOD:V-ADV (__SP__,as)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
OBJ:V-N (as,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCTGTGAACTCTGATCCAGTAAG)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-ADJ (protein,dominant)
MOD_ATT:N-ADJ (protein,negative)
MOD_ATT:N-ADJ (protein,mutant)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
APPOS (protein,truncation)
MOD_ATT:N-N (truncation,C)
MOD_ATT:N-ADJ (truncation,terminal)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 6

                                                                                                                                                                                                                                                                     +----------------------------MOD_ATT:N-ADJ----------------------------+                                                           
                                                                                                                                                                                                                                                                     |                             +-------------MOD_ATT:N-ADJ-------------+                                                           
                                                                                                                                                                                                                                                                     |                             |        +---------MOD_ATT:N-ADJ--------+                                                           
         +-------------------COMP:N-N(of)------------------+                                                                                                                                                                                                         |                             |        |       +-----MOD_ATT:N-ADJ----+---------APPOS--------+                                    
         +----COMP:N-N(of)----+                            |                                           +--------------SUBJ:V-N--------------+----------OBJ:V-N----------+---OBJ:V-N---+                +---COMP:N-N(of)--+                                           |                             |        |       |      +-MOD_ATT:N-ADJ-+      +--MOD_ATT:N-N--+              +-MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+-SUBJ:V-N-+          +MOD_AT+-------APPOS------+                        |                            +SUBJ:V-+OBJ:V-N+           +MOD_ATT+       +SUBJ:+--COMP:V-N(as)--+          +MOD_AT+-------APPOS------+                        |                             |        |       |      |       +MOD_ATT+      |     +MOD_ATT:N+              |       +MOD_ATT+     
         |          |         |          |          |      |                  |                        |                            |       |       |           |       |       |     |                |          |      |                  |                        |                             |        |       |      |       |       |      |     |         |              |       |       |     
 In a system of purified components , binding of a DNA fragment ( GATCTGTGAACTCTGATCCAGTAAG ) from __NODE__ response element and __SP__ __NODE__ protein and __SP__ __NODE__ protein is the same as binding of a DNA fragment ( GATCTGTGAACTCTGATCCAGTAAG ) from __NODE__ response element and dominant negative mutant __SP__ __NODE__ protein ( C terminal truncation ) and __SP__ __NODE__ protein .
COMP:N-N(of) (system,component)
COMP:N-N(of) (system,fragment)
MOD_ATT:N-ADJ (component,purify)
SUBJ:V-N (bind,component)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCTGTGAACTCTGATCCAGTAAG)
SUBJ:V-N (__NODE__,__NODE__)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)
OBJ:V-N (__NODE__,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)
OBJ:V-N (be,__NODE__)
SUBJ:V-N (be,protein)
COMP:V-N(as) (be,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCTGTGAACTCTGATCCAGTAAG)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-ADJ (protein,dominant)
MOD_ATT:N-ADJ (protein,negative)
MOD_ATT:N-ADJ (protein,mutant)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
APPOS (protein,truncation)
MOD_ATT:N-N (truncation,C)
MOD_ATT:N-ADJ (truncation,terminal)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 7

                                                                                                                                                                                                                                                                     +----------------------------MOD_ATT:N-ADJ----------------------------+                                                           
                                                                                                                                                                                                                                                                     |                             +-------------MOD_ATT:N-ADJ-------------+                                                           
                                                                                                                                                                                                                                                                     |                             |        +---------MOD_ATT:N-ADJ--------+                                                           
         +-------------------COMP:N-N(of)------------------+                                                                                                                                           +----------------APPOS---------------+                        |                             |        |       +-----MOD_ATT:N-ADJ----+---------APPOS--------+                                    
         +----COMP:N-N(of)----+                            |                                           +--------------SUBJ:V-N--------------+------OBJ:V-N------+-------OBJ:V-N-------+                +---COMP:N-N(of)--+                  |                        |                             |        |       |      +-MOD_ATT:N-ADJ-+      +--MOD_ATT:N-N--+              +-MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+-SUBJ:V-N-+          +MOD_AT+-------APPOS------+                        |                            +SUBJ:V-+OBJ:V-N+           |       +MOD_ATT+SUBJ:+                |          +MOD_AT+                  |                        |                             |        |       |      |       +MOD_ATT+      |     +MOD_ATT:N+              |       +MOD_ATT+     
         |          |         |          |          |      |                  |                        |                            |       |       |           |       |       |     |                |          |      |                  |                        |                             |        |       |      |       |       |      |     |         |              |       |       |     
 In a system of purified components , binding of a DNA fragment ( GATCTGTGAACTCTGATCCAGTAAG ) from __NODE__ response element and __SP__ __NODE__ protein and __SP__ __NODE__ protein is the same as binding of a DNA fragment ( GATCTGTGAACTCTGATCCAGTAAG ) from __NODE__ response element and dominant negative mutant __SP__ __NODE__ protein ( C terminal truncation ) and __SP__ __NODE__ protein .
COMP:N-N(of) (system,component)
COMP:N-N(of) (system,fragment)
MOD_ATT:N-ADJ (component,purify)
SUBJ:V-N (bind,component)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCTGTGAACTCTGATCCAGTAAG)
SUBJ:V-N (__NODE__,__NODE__)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,protein)
OBJ:V-N (__NODE__,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__SP__)
SUBJ:V-N (be,protein)
COMP:N-N(of) (bind,fragment)
APPOS (bind,GATCTGTGAACTCTGATCCAGTAAG)
MOD_ATT:N-N (fragment,DNA)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-ADJ (protein,dominant)
MOD_ATT:N-ADJ (protein,negative)
MOD_ATT:N-ADJ (protein,mutant)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
APPOS (protein,truncation)
MOD_ATT:N-N (truncation,C)
MOD_ATT:N-ADJ (truncation,terminal)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)

Analyse 8

                                                                                                                                                                                                                                                                     +----------------------------MOD_ATT:N-ADJ----------------------------+                                                           
                                                                                                                                                                                                                                                                     |                             +-------------MOD_ATT:N-ADJ-------------+                                                           
                                                                                                       +------------------------------------OBJ:V-N-----------------------------------+                                                                              |                             |        +---------MOD_ATT:N-ADJ--------+                                                           
         +-------------------COMP:N-N(of)------------------+                                           |                                            +-------------OBJ:V-N-------------+                                                                              |                             |        |       +-----MOD_ATT:N-ADJ----+---------APPOS--------+                                    
         +----COMP:N-N(of)----+                            +-------------------APPOS-------------------+                            +-MOD_ATT:N-ADJ-+           +-------OBJ:V-N-------+                +---COMP:N-N(of)--+                                           |                             |        |       |      +-MOD_ATT:N-ADJ-+      +--MOD_ATT:N-N--+              +-MOD_ATT:N-ADJ-+     
         |          +MOD_ATT:N+-SUBJ:V-N-+          +MOD_AT+                  +-------MOD_ATT:N-N------+                            |       +MOD_ATT+           |       +MOD_ATT+SUBJ:+-MOD:V-ADV-+OBJ:+          +MOD_AT+-------APPOS------+                        |                             |        |       |      |       +MOD_ATT+      |     +MOD_ATT:N+              |       +MOD_ATT+     
         |          |         |          |          |      |                  |                        |                            |       |       |           |       |       |     |           |    |          |      |                  |                        |                             |        |       |      |       |       |      |     |         |              |       |       |     
 In a system of purified components , binding of a DNA fragment ( GATCTGTGAACTCTGATCCAGTAAG ) from __NODE__ response element and __SP__ __NODE__ protein and __SP__ __NODE__ protein is the same as binding of a DNA fragment ( GATCTGTGAACTCTGATCCAGTAAG ) from __NODE__ response element and dominant negative mutant __SP__ __NODE__ protein ( C terminal truncation ) and __SP__ __NODE__ protein .
COMP:N-N(of) (system,component)
COMP:N-N(of) (system,fragment)
MOD_ATT:N-ADJ (component,purify)
SUBJ:V-N (bind,component)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,__NODE__)
MOD_ATT:N-N (__NODE__,GATCTGTGAACTCTGATCCAGTAAG)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-ADJ (protein,__NODE__)
OBJ:V-N (be,__NODE__)
OBJ:V-N (be,protein)
OBJ:V-N (be,__SP__)
SUBJ:V-N (be,protein)
MOD:V-ADV (be,as)
OBJ:V-N (as,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,GATCTGTGAACTCTGATCCAGTAAG)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-ADJ (protein,dominant)
MOD_ATT:N-ADJ (protein,negative)
MOD_ATT:N-ADJ (protein,mutant)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)
APPOS (protein,truncation)
MOD_ATT:N-N (truncation,C)
MOD_ATT:N-N (truncation,terminal)
MOD_ATT:N-ADJ (protein,__SP__)
MOD_ATT:N-ADJ (protein,__NODE__)