vers la météo de la validation par utilisateur

Ingenuity187

precedent - 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 - suivant

Phrase 63 - PMID ?

In a system of purified components , binding of double stranded __NODE__ Vitamin D response element ( 5 ' AGCTTAAGAGGTCAGAAAGGTCACTCGCAT 3 ' and a protein fragment ( 613 752 ) containing a LXXLL motif 1 2 3 from __NODE__ protein and a protein protein complex consisting of mutant __NODE__ ( allele rxr443 ) ( deletion with its AF 2 transcription activation domain deleted ) and of __NODE__ and vitamin D is greater than binding of double stranded __NODE__ Vitamin D response element ( 5 ' AGCTTAAGAGGTCAGAAAGGTCACTCGCAT 3 ' and a protein fragment ( 613 752 ) containing a LXXLL motif 1 2 3 from __NODE__ protein and a protein protein complex consisting of __NODE__ and of __NODE__ and vitamin D .


Non annotée
Je ne sais pas
Je n'ai pas trouvé d'analyse satisfaisante


Commentaires :
Analyse 0 
         +---------------COMP:V-N(In)---------------+                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    
         +----------COMP:V-N(In)---------+          +---------OBJ:V-N--------+                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           +---------------------------SUBJ:V-N---------------------------+            +----------COMP:N-N(of)----------+  
         |                    +-------SUBJ:V-N------+       +--MOD_ATT:N-ADJ-+                                            +---------------SUBJ:V-N--------------+                     +-------OBJ:V-N-------+---OBJ:V-N--+       +----------------SUBJ:V-N---------------+------------COMP:N-N(of)------------+------------------COMP:N-N(with)-----------------+               +---------------------MOD_ATT:N-ADJ---------------------+                                                                                                +-------SUBJ:V-N------+                     +------OBJ:V-N------+ +---COMP:N-N(from)---+             +--MOD_ATT:N-N--+         |            |               +---MOD_ATT:N-N--+  
         |          +MOD_ATT:N+-SUBJ:V-N-+          |       |        +MOD_ATT+                                            |                            +SUBJ:V-N+                     |         +MOD_A+     | +-SUBJ:V-N-+       |                     +-----SUBJ:V-N----+                   +MOD_ATT:N+      |                          +MOD_ATT:N+            |               |                             +MOD_+SU+    +MOD_ATT:N-AD+-----SUBJ:V-N-----+-------OBJ:V-N-------+-----------------APPOS-----------------+               |            +SUBJ:V-N+                     |         +MOD_A+   | |            +MOD_ATT+             |       +MOD_ATT+-SUBJ:V-N+COMP:N-N(of)+               |           +MOD_+  
         |          |         |          |          |       |        |       |                                            |                            |        |                     |         |     |     | |          |       |                     |                 |                   |         |      |                          |         |            |               |                             |    |  |    |            |                  |                     |                                       |               |            |        |                     |         |     |   | |            |       |             |       |       |         |            |               |           |    |  
 In a system of purified components , binding of double stranded __NODE__ Vitamin D response element ( 5 ' AGCTTAAGAGGTCAGAAAGGTCACTCGCAT 3 ' and a protein fragment ( 613 752 ) containing a LXXLL motif 1 2 3 from __NODE__ protein and a protein protein complex consisting of mutant __NODE__ ( allele rxr443 ) ( deletion with its AF 2 transcription activation domain deleted ) and of __NODE__ and vitamin D is greater than binding of double stranded __NODE__ Vitamin D response element ( 5 ' AGCTTAAGAGGTCAGAAAGGTCACTCGCAT 3 ' and a protein fragment ( 613 752 ) containing a LXXLL motif 1 2 3 from __NODE__ protein and a protein protein complex consisting of __NODE__ and of __NODE__ and vitamin D .
MOD_ATT:N-ADJ (component,purify)
COMP:V-N(In) (bind,system)
SUBJ:V-N (bind,component)
COMP:V-N(In) (double,system)
SUBJ:V-N (double,component)
OBJ:V-N (double,vitamin)
MOD_ATT:N-ADJ (vitamin,strand)
MOD_ATT:N-ADJ (vitamin,__NODE__)
SUBJ:V-N (fragment,AGCTTAAGAGGTCAGAAAGGTCACTCGCAT)
SUBJ:V-N (fragment,protein)
OBJ:V-N (contain,2)
MOD_ATT:N-N (motif,LXXLL)
OBJ:V-N (__NODE__,2)
SUBJ:V-N (__NODE__,3)
SUBJ:V-N (consist,protein)
SUBJ:V-N (consist,protein)
COMP:N-N(of) (consist,rxr443)
MOD_ATT:N-ADJ (allele,__NODE__)
COMP:N-N(with) (rxr443,activation)
MOD_ATT:N-N (transcription,AF)
MOD_ATT:N-N (D,vitamin)
SUBJ:V-N (be,D)
MOD_ATT:N-ADJ (bind,delete)
MOD_ATT:N-ADJ (bind,great)
SUBJ:V-N (strand,bind)
OBJ:V-N (strand,D)
APPOS (D,AGCTTAAGAGGTCAGAAAGGTCACTCGCAT)
SUBJ:V-N (fragment,3)
SUBJ:V-N (fragment,protein)
OBJ:V-N (contain,1)
MOD_ATT:N-N (motif,LXXLL)
COMP:N-N(from) (2,protein)
MOD_ATT:N-ADJ (protein,__NODE__)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,1)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (__NODE__,D)
MOD_ATT:N-N (D,__NODE__)
MOD_ATT:N-N (D,vitamin)