In a system of purified components , binding of a DNA fragment ( 217 193 ) ( 5 ' CCTGTCGGCCCCGCCCGAGAACCTC 3 ' containing a __NODE__ binding site 3 from __SP__ __NODE__ gene and a protein protein complex consisting of __SP__ __NODE__ and of __SP__ __NODE__ and of __SP__ __NODE__ is greater than or equal to binding of a DNA fragment ( 135 111 ) ( 5 ' GCGCAAGGGCGGCCAGAGAACCCAG 3 ' containing a __NODE__ binding site 1 from __SP__ __NODE__ gene and a protein protein complex consisting of __SP__ __NODE__ and of __SP__ __NODE__ and of __SP__ __NODE__ .