Validation pour Ingenuity187

vers la météo de la validation par utilisateur

Ingenuity187

precedent - 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 - suivant

Phrase 26 - PMID ?

In a system of purified components , binding of a DNA fragment ( 154 130 ) ( 5 ' ATCCCATGCGCGAGGGCGGGCGCAA 3 ' containing a NODE binding site 2 from SP NODE gene and a protein protein complex consisting of SP NODE and of SP NODE and of SP NODE is greater than binding of a DNA fragment ( 217 193 ) ( 5 ' CCTGTCGGCCCCGCCCGAGAACCTC 3 ' containing a NODE binding site 3 from SP NODE gene and a protein protein complex consisting of SP NODE and of SP NODE and of SP NODE .

Non annotée
Je ne sais pas
Je n'ai pas trouvé d'analyse satisfaisante

Commentaires :

Analyse 0

                                                                                                                                                                                                                                                                                                                                                                                                                                                                   +------------------------------------COMP:N-N(of)-----------------------------------+     
                                                                                                                                                                            +-------------MOD_ATT:N-N-------------+                                                                                                                                                                                 +--------------OBJ:V-N--------------+                          +------------------------------------COMP:N-N(of)-----------------------------------+     
                    +---------MOD_ATT:N-ADJ---------+              +-------MOD_ATT:N-ADJ------+             +----------SUBJ:V-N----------+----------OBJ:V-N----------+      |           +-------MOD_ATT:N-N-------+-----------------SUBJ:V-N-----------------+                                                                                                                 +-----MOD_ATT:N-N----+                 +-----SUBJ:V-N----+      +----MOD_ATT:N-N----+-------------COMP:N-N(of)------------+                                             |     
                    |         +-SUBJ:V-N-+          |              |   +-APPOS+               |             +SUBJ:V-N+--OBJ:V-N--+       +---COMP:V-N(from)--+       |      |           |       +---MOD_ATT:N-N---+COMP:N-N(of+                      +SUBJ:V-+--------OBJ:V-N-------+     +-----SUBJ:V-N----+                                                                  |        +MOD_ATT:N-N+SUBJ:V-+         +COMP:N-N(+       |      |           +MOD_ATT+                             +MOD_ATT+                                             |     
                    |         |          |          |              |   |      |               |             |        |           |       |                   |       |      |           |       |                 |           |                      |       |                      |     |                 |                                                                  |        |           |       |         |         |       |      |           |       |                             |       |                                             |     
 In a system of purified components , binding of a DNA fragment ( 154 130 ) ( 5 ' ATCCCATGCGCGAGGGCGGGCGCAA 3 ' containing a __NODE__ binding site 2 from __SP__ __NODE__ gene and a protein protein complex consisting of __SP__ __NODE__ and of __SP__ __NODE__ and of __SP__ __NODE__ is greater than binding of a DNA fragment ( 217 193 ) ( 5 ' CCTGTCGGCCCCGCCCGAGAACCTC 3 ' containing a __NODE__ binding site 3 from __SP__ __NODE__ gene and a protein protein complex consisting of __SP__ __NODE__ and of __SP__ __NODE__ and of __SP__ __NODE__ .
SUBJ:V-N (bind,component)
MOD_ATT:N-ADJ (DNA,purify)
APPOS (@card@,5)
MOD_ATT:N-ADJ (ATCCCATGCGCGAGGGCGGGCGCAA,@card@)
SUBJ:V-N (contain,3)
OBJ:V-N (contain,__NODE__)
SUBJ:V-N (binding,3)
COMP:V-N(from) (binding,__SP__)
OBJ:V-N (binding,__NODE__)
MOD_ATT:N-N (consist,gene)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,protein)
COMP:N-N(of) (consist,__SP__)
SUBJ:V-N (__NODE__,consist)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,__NODE__)
SUBJ:V-N (be,bind)
MOD_ATT:N-N (__NODE__,3)
MOD_ATT:N-N (__NODE__,contain)
SUBJ:V-N (binding,__NODE__)
COMP:N-N(from) (3,__SP__)
OBJ:V-N (__NODE__,__NODE__)
SUBJ:V-N (__NODE__,3)
MOD_ATT:N-N (protein,gene)
MOD_ATT:N-N (protein,protein)
COMP:N-N(of) (protein,__NODE__)
COMP:N-N(of) (protein,__NODE__)
COMP:N-N(of) (protein,__NODE__)
MOD_ATT:N-ADJ (__NODE__,__SP__)