vers la météo de la validation par utilisateur

Ingenuity200

precedent - 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 - suivant

Phrase 67 - PMID ?

In cell free system , binding of a DNA fragment ( 5 ' GGGTTTGACCTTTCTCTCCGGGTAAAGGTGAAGG 3 ' containing a NRRE 1 from __SP__ __NODE__ gene and a protein protein complex consisting of __SP__ __NODE__ and of __SP__ __NODE__ is the same as binding of a mutant DNA fragment ( G?T G?T T?C ) ( 5 ' GGGTTTGACCTTTCTCTCCGTTCAAAGGTGAAGG 3 ' containing a NRRE 1 from __SP__ __NODE__ gene and a protein protein complex consisting of __SP__ __NODE__ and of __SP__ __NODE__ .


Non annotée
Je ne sais pas
Je n'ai pas trouvé d'analyse satisfaisante


Commentaires :
Analyse 0 
                                                                                                                                         +-------------MOD_ATT:N-N-------------+                                                                                                                                                                              +--------------------------MOD_ATT:N-N-------------------------+                                                
                                                                                                   +------------OBJ:V-N-----------+      |                   +---MOD_ATT:N-N---+-----------------SUBJ:V-N-----------------+--------OBJ:V-N-------+----------COMP:N-N(of)----------+                                                                           |                                            +---MOD_ATT:N-N---+-----------------SUBJ:V-N-----------------+     
           +---------OBJ:V-N---------+------------------------APPOS-----------------------+SUBJ:V-N+----COMP:V-N(from)----+       |      |                   |       +MOD_ATT:N+           +MOD_ATT+              +SUBJ:V-+     +SUBJ:V-+        |            +---MOD_ATT:N-ADJ---+-----APPOS----+                                               +-OBJ:V-N-+  |                                            |       +MOD_ATT:N+COMP:N-N(of+                      +SUBJ:V-+     
           |                         |                                                    |        |                      |       |      |                   |       |         |           |       |              |       |     |       |        |            |                   |              |                                               |         |  |                                            |       |         |           |                      |       |     
 In cell free system , binding of a DNA fragment ( 5 ' GGGTTTGACCTTTCTCTCCGGGTAAAGGTGAAGG 3 ' containing a NRRE 1 from __SP__ __NODE__ gene and a protein protein complex consisting of __SP__ __NODE__ and of __SP__ __NODE__ is the same as binding of a mutant DNA fragment ( G?T G?T T?C ) ( 5 ' GGGTTTGACCTTTCTCTCCGTTCAAAGGTGAAGG 3 ' containing a NRRE 1 from __SP__ __NODE__ gene and a protein protein complex consisting of __SP__ __NODE__ and of __SP__ __NODE__ .
OBJ:V-N (free,DNA)
APPOS (DNA,3)
SUBJ:V-N (contain,3)
COMP:V-N(from) (contain,__SP__)
OBJ:V-N (contain,__NODE__)
MOD_ATT:N-N (consist,gene)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
MOD_ATT:N-ADJ (__NODE__,__SP__)
SUBJ:V-N (__NODE__,consist)
SUBJ:V-N (__NODE__,__SP__)
OBJ:V-N (__NODE__,bind)
SUBJ:V-N (be,same)
COMP:N-N(of) (bind,G?T)
MOD_ATT:N-ADJ (G?T,mutant)
APPOS (G?T,5)
OBJ:V-N (contain,NRRE)
MOD_ATT:N-N (consist,1)
MOD_ATT:N-N (consist,protein)
MOD_ATT:N-N (consist,complex)
COMP:N-N(of) (consist,__SP__)
SUBJ:V-N (__NODE__,consist)
SUBJ:V-N (__NODE__,__SP__)