In cell free system , binding of a protein fragment ( 568 781 ) containing a receptor interacting domain from __SP__ __NODE__ protein in cell free system and homodimeric __SP__ __NODE__ protein in cell free system is necessary for stabilization of a protein DNA complex consisting of promoter fragment ( TTTTCCTGGGCATTCTGGGTCAAAGTTGATCCCCTCCTG ) containing a PPRE from __SP__ Me gene(s) and of homodimeric __SP__ __NODE__ .