Validation pour Ingenuity176

vers la météo de la validation par utilisateur

Ingenuity176

precedent - 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 - suivant

Phrase 3 - PMID ?

In a cell free system , binding of a DNA fragment ( TCGACAGGGTCATTTCAGGTCCTTGC ) from SP and a protein protein complex consisting of NODE and of NODE is greater than binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGAGGTAATATC ) from SP NODE gene and a protein protein complex consisting of NODE and of NODE .

Non annotée
Je ne sais pas
Je n'ai pas trouvé d'analyse satisfaisante

Commentaires :

Analyse 0

                                                                                                                                 +-------------MOD_PRED:N-ADJ------------+            +-------------------APPOS------------------+                                    +------------------SUBJ:V-N------------------+                                  
             +----OBJ:V-N---+---COMP:N-N(of)--+                                           +-------------MOD_ATT:N-ADJ------------+--------COMP:N-N(of)--------+          |            +---COMP:N-N(of)--+                        |                                    |                  +--MOD_ATT:N-N--+         |                                  
             |     +MOD_ATT:+          +MOD_AT+-------APPOS-------+                       |            +MOD_ATT+       +MOD_ATT:N+COMP:N-N(of)+               |          |      +OBJ:V+          +MOD_AT+                        |                            +MOD_ATT+                  |       +MOD_ATT+-SUBJ:V-N+COMP:N-N(of)+--COMP:N-N(of)-+     
             |     |        |          |      |                   |                       |            |       |       |         |            |               |          |      |     |          |      |                        |                            |       |                  |       |       |         |            |               |     
 In a cell free system , binding of a DNA fragment ( TCGACAGGGTCATTTCAGGTCCTTGC ) from __SP__ and a protein protein complex consisting of __NODE__ and of __NODE__ is greater than binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGAGGTAATATC ) from __SP__ __NODE__ gene and a protein protein complex consisting of __NODE__ and of __NODE__ .
OBJ:V-N (free,bind)
MOD_ATT:N-N (bind,system)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACAGGGTCATTTCAGGTCCTTGC)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-ADJ (consist,__SP__)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_PRED:N-ADJ (consist,great)
OBJ:V-N (than,bind)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACTTCCAAAATGGGGATTAAATGAGGTAATATC)
MOD_ATT:N-N (fragment,DNA)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,__NODE__)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (__NODE__,__NODE__)

Analyse 1

                            +----------------APPOS----------------+                                                              +-------------MOD_PRED:N-ADJ------------+                                                                                            +------------------SUBJ:V-N------------------+                                  
             +----OBJ:V-N---+---COMP:N-N(of)--+                   |                       +-------------MOD_ATT:N-ADJ------------+--------COMP:N-N(of)--------+          |      +------COMP:N-N(of)-----+                                                             |                  +--MOD_ATT:N-N--+         +--------COMP:N-N(of)--------+     
             |     +MOD_ATT:+          +MOD_AT+                   |                       |            +MOD_ATT+       +MOD_ATT:N+COMP:N-N(of)+               |          |      +OBJ:V+          +MOD_AT+----------APPOS---------+                            +MOD_ATT+                  |       +MOD_ATT+-SUBJ:V-N+COMP:N-N(of)+               |     
             |     |        |          |      |                   |                       |            |       |       |         |            |               |          |      |     |          |      |                        |                            |       |                  |       |       |         |            |               |     
 In a cell free system , binding of a DNA fragment ( TCGACAGGGTCATTTCAGGTCCTTGC ) from __SP__ and a protein protein complex consisting of __NODE__ and of __NODE__ is greater than binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGAGGTAATATC ) from __SP__ __NODE__ gene and a protein protein complex consisting of __NODE__ and of __NODE__ .
OBJ:V-N (free,bind)
MOD_ATT:N-N (bind,system)
COMP:N-N(of) (bind,fragment)
APPOS (bind,TCGACAGGGTCATTTCAGGTCCTTGC)
MOD_ATT:N-N (fragment,DNA)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-ADJ (consist,__SP__)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_PRED:N-ADJ (consist,great)
OBJ:V-N (than,bind)
COMP:N-N(of) (than,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGAGGTAATATC)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,__NODE__)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)

Analyse 2

                            +-----OBJ:V-N-----+                                                                                  +-------------MOD_PRED:N-ADJ------------+                                                                                            +------------------SUBJ:V-N------------------+                                  
        +MOD_ATT:N-+        +---OBJ:V_PASS-N--+                                           +-------------MOD_ATT:N-ADJ------------+--------COMP:N-N(of)--------+          |            +---COMP:N-N(of)--+                                                             |                  +--MOD_ATT:N-N--+         |                                  
        |    +MOD_A+SUBJ:V-N+          +MOD_AT+-------APPOS-------+                       |            +MOD_ATT+       +MOD_ATT:N+COMP:N-N(of)+               |          |      +OBJ:V+          +MOD_AT+----------APPOS---------+                            +MOD_ATT+                  |       +MOD_ATT+-SUBJ:V-N+COMP:N-N(of)+--COMP:N-N(of)-+     
        |    |     |        |          |      |                   |                       |            |       |       |         |            |               |          |      |     |          |      |                        |                            |       |                  |       |       |         |            |               |     
 In a cell free system , binding of a DNA fragment ( TCGACAGGGTCATTTCAGGTCCTTGC ) from __SP__ and a protein protein complex consisting of __NODE__ and of __NODE__ is greater than binding of a DNA fragment ( TCGACTTCCAAAATGGGGATTAAATGAGGTAATATC ) from __SP__ __NODE__ gene and a protein protein complex consisting of __NODE__ and of __NODE__ .
MOD_ATT:N-N (system,cell)
MOD_ATT:N-ADJ (system,free)
SUBJ:V-N (bind,system)
OBJ:V-N (bind,fragment)
OBJ:V_PASS-N (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACAGGGTCATTTCAGGTCCTTGC)
MOD_ATT:N-N (protein,protein)
MOD_ATT:N-ADJ (consist,__SP__)
MOD_ATT:N-ADJ (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (consist,__NODE__)
MOD_PRED:N-ADJ (consist,great)
OBJ:V-N (than,bind)
COMP:N-N(of) (bind,fragment)
MOD_ATT:N-N (fragment,DNA)
APPOS (fragment,TCGACTTCCAAAATGGGGATTAAATGAGGTAATATC)
MOD_ATT:N-ADJ (__NODE__,__SP__)
MOD_ATT:N-N (complex,protein)
MOD_ATT:N-N (complex,protein)
SUBJ:V-N (consist,__NODE__)
SUBJ:V-N (consist,complex)
COMP:N-N(of) (consist,__NODE__)
COMP:N-N(of) (__NODE__,__NODE__)